View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4829-Insertion-12 (Length: 61)
Name: NF4829-Insertion-12
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4829-Insertion-12 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 8 - 61
Target Start/End: Original strand, 37270065 - 37270118
Alignment:
| Q |
8 |
tttggaactcacctcactattccaacaatcaaattgcacaaacaggttatgcgg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37270065 |
tttggaactcacctcactattccaacaatcaaattgcacaaacaggttatgcgg |
37270118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 42941102 - 42941049
Alignment:
| Q |
8 |
tttggaactcacctcactattccaacaatcaaattgcacaaacaggttatgcgg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42941102 |
tttggaactcacctcactattccaacaatcaaattgcacaaacaggttatgcgg |
42941049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.00000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.00000006
Query Start/End: Original strand, 23 - 51
Target Start/End: Original strand, 28347394 - 28347422
Alignment:
| Q |
23 |
actattccaacaatcaaattgcacaaaca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28347394 |
actattccaacaatcaaattgcacaaaca |
28347422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 27; E-Value: 0.000001
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 36988883 - 36988841
Alignment:
| Q |
16 |
tcacctcactattccaacaatcaaattgcacaaacaggttatg |
58 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
36988883 |
tcacttcactattccaacaatcaaaatggacaaaaaggttatg |
36988841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University