View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4829_high_2 (Length: 316)

Name: NF4829_high_2
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4829_high_2
NF4829_high_2
[»] chr4 (3 HSPs)
chr4 (158-296)||(29631638-29631776)
chr4 (13-122)||(29631494-29631603)
chr4 (221-254)||(28390248-28390281)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 158 - 296
Target Start/End: Original strand, 29631638 - 29631776
Alignment:
158 ctcagcagctagctattgcaatacaacggactgtgataacgctggaaacgacaaacacacgtcgttttcagatctcggactctcggaatggatggtgcgg 257  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
29631638 ctcagcagctagctattgtaatacaacggactgtgataacgctggaaacgacaaacacatgtcgttttcagatctaggactctcggaatggatggtgcgg 29631737  T
258 ggttgcgataaactcgggatgcaatctcctcggcccgtg 296  Q
    ||||||||||||||||||||||||||||| |||||||||    
29631738 ggttgcgataaactcgggatgcaatctccgcggcccgtg 29631776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 29631494 - 29631603
Alignment:
13 tgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaac 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29631494 tgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaac 29631593  T
113 agcttacttc 122  Q
    ||||||||||    
29631594 agcttacttc 29631603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 254
Target Start/End: Complemental strand, 28390281 - 28390248
Alignment:
221 gttttcagatctcggactctcggaatggatggtg 254  Q
    ||||||||||||||||||||| ||||||||||||    
28390281 gttttcagatctcggactctcagaatggatggtg 28390248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University