View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4829_high_2 (Length: 316)
Name: NF4829_high_2
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4829_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 158 - 296
Target Start/End: Original strand, 29631638 - 29631776
Alignment:
| Q |
158 |
ctcagcagctagctattgcaatacaacggactgtgataacgctggaaacgacaaacacacgtcgttttcagatctcggactctcggaatggatggtgcgg |
257 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29631638 |
ctcagcagctagctattgtaatacaacggactgtgataacgctggaaacgacaaacacatgtcgttttcagatctaggactctcggaatggatggtgcgg |
29631737 |
T |
 |
| Q |
258 |
ggttgcgataaactcgggatgcaatctcctcggcccgtg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29631738 |
ggttgcgataaactcgggatgcaatctccgcggcccgtg |
29631776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 29631494 - 29631603
Alignment:
| Q |
13 |
tgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631494 |
tgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaac |
29631593 |
T |
 |
| Q |
113 |
agcttacttc |
122 |
Q |
| |
|
|||||||||| |
|
|
| T |
29631594 |
agcttacttc |
29631603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 254
Target Start/End: Complemental strand, 28390281 - 28390248
Alignment:
| Q |
221 |
gttttcagatctcggactctcggaatggatggtg |
254 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
28390281 |
gttttcagatctcggactctcagaatggatggtg |
28390248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University