View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4829_high_4 (Length: 267)
Name: NF4829_high_4
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4829_high_4 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 43003663 - 43003914
Alignment:
| Q |
18 |
cgttcatattgcatctgggcagtcgcagatcccggagggagccagcatttttagcaatgaaagtgaaactctttctagtccggagacccgaaacgatgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43003663 |
cgttcatattgcatctgggcagtcgcagatcccggagggagccagcatttttagcaatgaaagtgaaactctttctagtccggagacctgaaacgatgag |
43003762 |
T |
 |
| Q |
118 |
ttttcggagcgatccagagcttctagcaatcaacatctgaaccatccgctcatttttccgatgctcgtaaatgc--tgctccagtcagtgatttctatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43003763 |
ttttcggagcgatccagagcttctagcaatcaacatctgaaccatccgctcatttttccgatgctcgtaaatgctgtgctccagtcagtgatttctatct |
43003862 |
T |
 |
| Q |
216 |
cttgccaacagtaaggtccataaacagcactggcccaagatttgcataccat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003863 |
cttgccaacagtaaggtccataaacagcactggcccaagatttgcataccat |
43003914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 94 - 261
Target Start/End: Complemental strand, 27071787 - 27071620
Alignment:
| Q |
94 |
agtccggagacccgaaacgatgagttttcggagcgatccagagcttctagcaatcaacatctgaaccatccgctcatttttccgatgctcgtaaatgctg |
193 |
Q |
| |
|
|||| ||| ||| |||||| ||||||| |||||||||||||| ||||||| ||||| ||||||||||||||||||| || || |||| | |||| |
|
|
| T |
27071787 |
agtctggataccagaaacgctgagtttccggagcgatccagaacttctagtaatcagcatctgaaccatccgctcaacttgtggaggctcagagtagctg |
27071688 |
T |
 |
| Q |
194 |
ctccagtcagtgatttctatctcttgccaacagtaaggtccataaacagcactggcccaagatttgca |
261 |
Q |
| |
|
| ||||||||| || ||||||||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
27071687 |
caccagtcagttatgtctatctcttgccaacagtaaggaccatttacagcactggcccatgatttgca |
27071620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University