View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4830-Insertion-13 (Length: 299)
Name: NF4830-Insertion-13
Description: NF4830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4830-Insertion-13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 8 - 299
Target Start/End: Complemental strand, 43405830 - 43405536
Alignment:
| Q |
8 |
cttaacatcaaccaaactgaagtagaccatcaccaaacggtctgtttcagattgaaattattgcctctcca---tatcttctataacgtttgacttattt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43405830 |
cttaacatcaaccaaactgaagtagaccatcaccaaacggtctgtttcagattgaaattattgcctctccaccatatcttctataacgtttgacttattt |
43405731 |
T |
 |
| Q |
105 |
tgaagtggcccacgttgtgggcccaaaaagcaaaaagaagtgacccaacaaagtgattttctgaagattatgtctgggtggctctgcctctatggttcca |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43405730 |
tgaagtggcccacgttgtggacccaaaaagcaaaaagaagtgacccaacaaaatgattttctgaagattatgtctgggtggctctgcctctatggttcca |
43405631 |
T |
 |
| Q |
205 |
acacagcctgtaaggtacatgcggtgtcctgtgaaggaagaatattcttacatattctgggtgtatcacatttaacggcttatattttactatgg |
299 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43405630 |
acacagcctgtaaggcacatgcggtgtcctgtgaaggaagaatattcttacatattctgggtgtatcacatttaacggcttatattttactatgg |
43405536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University