View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4830-Insertion-16 (Length: 103)

Name: NF4830-Insertion-16
Description: NF4830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4830-Insertion-16
NF4830-Insertion-16
[»] chr2 (1 HSPs)
chr2 (9-103)||(2425234-2425326)
[»] chr4 (1 HSPs)
chr4 (12-51)||(36723418-36723457)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 9 - 103
Target Start/End: Original strand, 2425234 - 2425326
Alignment:
9 gttaaaccataccgggaacaaactgattggggaataatcttcaaagaagtaaaagaatnnnnnnnntttaatgtaaacctgttataagcaatata 103  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||          ||||||||||||||||||||||||||||    
2425234 gttaaaccataccgggaacaaactgattgaggaataatcttcaaagaagtaaaagaa--aaaaaaaattaatgtaaacctgttataagcaatata 2425326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 36723457 - 36723418
Alignment:
12 aaaccataccgggaacaaactgattggggaataatcttca 51  Q
    |||||||| || ||||||||||||||||| ||||||||||    
36723457 aaaccatatcgagaacaaactgattggggtataatcttca 36723418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University