View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4830-Insertion-16 (Length: 103)
Name: NF4830-Insertion-16
Description: NF4830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4830-Insertion-16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 9 - 103
Target Start/End: Original strand, 2425234 - 2425326
Alignment:
| Q |
9 |
gttaaaccataccgggaacaaactgattggggaataatcttcaaagaagtaaaagaatnnnnnnnntttaatgtaaacctgttataagcaatata |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2425234 |
gttaaaccataccgggaacaaactgattgaggaataatcttcaaagaagtaaaagaa--aaaaaaaattaatgtaaacctgttataagcaatata |
2425326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 36723457 - 36723418
Alignment:
| Q |
12 |
aaaccataccgggaacaaactgattggggaataatcttca |
51 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
36723457 |
aaaccatatcgagaacaaactgattggggtataatcttca |
36723418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University