View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4830_high_5 (Length: 351)
Name: NF4830_high_5
Description: NF4830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4830_high_5 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 203 - 351
Target Start/End: Complemental strand, 30400492 - 30400344
Alignment:
| Q |
203 |
atgatgacagatactctcaactttgtgaagaaaacaaatgaatagaagaaaagaggttagaggagttaaagtcattctctttgatttgttttattatagc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
30400492 |
atgatgacagatactctcaactttgtgaagaaaacaaatgaatagaagaaaagaggttagaggagttaaagtaattctctttgattagttttattatagc |
30400393 |
T |
 |
| Q |
303 |
gagttagcaataactctatacccacattatttgtaatggaaggttaggt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30400392 |
gagttagcaataactctatacccacattatttgtaatggaatgttaggt |
30400344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 34899975 - 34899864
Alignment:
| Q |
1 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
 |
| Q |
101 |
attgtgtcttcc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34899875 |
attgtgtcttcc |
34899864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University