View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4831_high_4 (Length: 369)
Name: NF4831_high_4
Description: NF4831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4831_high_4 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 359
Target Start/End: Original strand, 46845132 - 46845487
Alignment:
| Q |
19 |
taaacccaatgcaatggttaattgttcatggtggtggcagcagcgggtttcttgttctttgtgagaatagtctttgggtttcttgttgttgctttgtatg |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46845132 |
taaacccaatgcaatggttaactgttcatggtggtggcagcagcgggtttcttgttctttgtgagaatagtctttgggtttcttgttgttgctttgtatg |
46845231 |
T |
 |
| Q |
119 |
agctagataacccctaaagtatcatgtaccaattgcataggaggatttatctcattgcataaatattcaaaagccaacattaagattggattgtgga--- |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46845232 |
agctagataacccctaaagtatcatgtaccaattgcataggaggatttatctcattgcataaatattcaaaagccaacattaagattggattgtggaagt |
46845331 |
T |
 |
| Q |
216 |
------------gatttgattcttttgtatgatttttcatcaattctccccaagaannnnnnnnnnnattgttttgtagattttaactcttgaaaaggca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46845332 |
agttactgttctgatttgattcttttgtatgatttttcatcaattctccccaagattttttttttttattgttttgtagattttaactcttgaaaaggca |
46845431 |
T |
 |
| Q |
304 |
ccccatagcacctgacccaagcacccctctcataaggcacactagcatccttcatc |
359 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46845432 |
ccccgtagcacctgacccaagcacccctctcataaggcacactagcatccttcatc |
46845487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 356
Target Start/End: Complemental strand, 220598 - 220542
Alignment:
| Q |
300 |
ggcaccccatagcacctgacccaagcacccctctcataaggcacactagcatccttc |
356 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |||||| ||||||| |
|
|
| T |
220598 |
ggcaccccataacacctgacccatgcacccctctcataaggtacactactatccttc |
220542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University