View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4834-Insertion-13 (Length: 163)
Name: NF4834-Insertion-13
Description: NF4834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4834-Insertion-13 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 8e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 8e-81
Query Start/End: Original strand, 8 - 163
Target Start/End: Original strand, 1904878 - 1905033
Alignment:
| Q |
8 |
gaagctaggtctccaaaccatatgttgcttttcatcctcaaccaaccagcacaatttatgatttttcaacttatttgagtttagttcttttgctcatttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1904878 |
gaagctaggtctccaaaccatatgttgcttttcatcctcaaccaaccagcacaatttatgatttttcaacttatttgagtttagttcttttgctcatttc |
1904977 |
T |
|
| Q |
108 |
tgatttcaatgattgttaaagggttcatttgtgtatatttttaatgcattttgcag |
163 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1904978 |
tgatttcaatgattgttaaagtgttcatttgtgtatatttttaatgcattttgcag |
1905033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 152; E-Value: 8e-81
Query Start/End: Original strand, 8 - 163
Target Start/End: Original strand, 1909111 - 1909266
Alignment:
| Q |
8 |
gaagctaggtctccaaaccatatgttgcttttcatcctcaaccaaccagcacaatttatgatttttcaacttatttgagtttagttcttttgctcatttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1909111 |
gaagctaggtctccaaaccatatgttgcttttcatcctcaaccaaccagcacaatttatgatttttcaacttatttgagtttagttcttttgctcatttc |
1909210 |
T |
|
| Q |
108 |
tgatttcaatgattgttaaagggttcatttgtgtatatttttaatgcattttgcag |
163 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1909211 |
tgatttcaatgattgttaaagtgttcatttgtgtatatttttaatgcattttgcag |
1909266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University