View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4834-Insertion-16 (Length: 289)
Name: NF4834-Insertion-16
Description: NF4834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4834-Insertion-16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 25379633 - 25379483
Alignment:
| Q |
8 |
cctggtccactgtgagaatgaaaaaacttgcacaataagcacataaaatatagtcattaaaatgataattaaacaaatagattgattagtttaccttgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379633 |
cctggtccactgtgagaatgaaaaaacttgcacaataagcacataaaatatagtcattaaaatgataattaaacaaatagattgattagtttaccttgtc |
25379534 |
T |
|
| Q |
108 |
tttttcttcgccgagaagaacgagagaactttttgggtggttctttagtag |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379533 |
tttttcttcgccgagaagaacgagagaactttttgggtggttctttagtag |
25379483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 25379385 - 25379352
Alignment:
| Q |
256 |
cttagatgaattatccacttcgtccttgtcatca |
289 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
25379385 |
cttagatgaattatccacttcgtcctcgtcatca |
25379352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University