View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4834_high_10 (Length: 315)
Name: NF4834_high_10
Description: NF4834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4834_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 33833210 - 33833490
Alignment:
| Q |
13 |
attctggaatattatttctgcaaagtcatgaagggtgaaacctaagacagatgtgccaagtttgacagatttgcttgaagaaggaaagtccttgattgta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33833210 |
attctggaatattatttctgcaaagtcatgaagggtgaaacctaagacagatgtgccaagtttgacagatttgcttgaagaaggaaagtccttgattgtg |
33833309 |
T |
 |
| Q |
113 |
ttgatatcaaagatgccaggaatgttaaaccaatcagcaagcttcaatggggtgcttggattgatgtgtgaaattccatttactgcatatcttaactttc |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33833310 |
ttgagatcaaagatgccaggaatgttaaaccaatcagcaagcttcaatggtgtgcttggattgatgtgtgaaattccatttactgcatatcttaactttc |
33833409 |
T |
 |
| Q |
213 |
cattcacaatggatttagaatttgctaattgcagtaccctcaacacagggatggttccatagtgaaatgatccttgaggat |
293 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33833410 |
cattcacaatggatttagaatttgccaattgcagtaccctcaacacagggatggttccatagtgaaatgatccttgaggat |
33833490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University