View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4836-Insertion-10 (Length: 336)
Name: NF4836-Insertion-10
Description: NF4836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4836-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 275
Target Start/End: Original strand, 6517650 - 6517918
Alignment:
| Q |
7 |
aacaataattatggatgtttcaagctttaaaacgtgaacgagnnnnnnncattaaaaaataatttggccggctatatattcgtctgttgctagtttttaa |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517650 |
aacaataattattgatgtttcaagctttaaaacgtgaacgagtttttttcattaaaaaataatttggccggctatatattcgtctgttgctagtttttaa |
6517749 |
T |
|
| Q |
107 |
aactatttgaaacaaaatttcactttcctttttatagaagaaactaacctttcttagatggaggaacatcatataattaatatgcaatttctcatttctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517750 |
aactatttgaaacaaaatttcactttcctttttatagaagaaactaacctttcttagatggagaaacatcatataattaatatgcaatttctcatttctc |
6517849 |
T |
|
| Q |
207 |
ccttaatatgttagttttgctgctagttttcttaggagnnnnnnnnttggtatacattaagtgtagatc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6517850 |
ccttaatatgttagttttgctgctagttttcttaggagaaaaaaaattggtatacattaagtgtagatc |
6517918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 56 - 142
Target Start/End: Original strand, 6513335 - 6513420
Alignment:
| Q |
56 |
cattaaaaaataatttggccggctatatattcgtctgttgctagtttttaaaactatttgaaacaaaatttcactttcctttttata |
142 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||| || ||||||| ||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
6513335 |
cattgaaaaagaatttggccggctatagattcgactattgctagcttttaaaacta-ttcaaccaaaatttcactttcgtttttata |
6513420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 302 - 336
Target Start/End: Original strand, 6517945 - 6517979
Alignment:
| Q |
302 |
cgaactagagatttagtgatattcatcaactgtaa |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517945 |
cgaactagagatttagtgatattcatcaactgtaa |
6517979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 7 - 38
Target Start/End: Complemental strand, 6521385 - 6521354
Alignment:
| Q |
7 |
aacaataattatggatgtttcaagctttaaaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6521385 |
aacaataattatggatgtttcaagctttaaaa |
6521354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 336
Target Start/End: Original strand, 6518149 - 6518178
Alignment:
| Q |
307 |
tagagatttagtgatattcatcaactgtaa |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6518149 |
tagagatttagtgatattcatcaactgtaa |
6518178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University