View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4836_high_5 (Length: 384)
Name: NF4836_high_5
Description: NF4836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4836_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 67 - 189
Target Start/End: Complemental strand, 44311296 - 44311174
Alignment:
| Q |
67 |
atctaaaactaaaactgatgagcgaataataggaacaaaattaagaaaggagagaagttgaaattgagatttacatcacaatatgttaattgaatgacaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311296 |
atctaaaactaaaactgatgagcgaataatagaaacaaaattaagaaaggagagaagttgaaattgagatttacatcacaatatgttaattgaatgacaa |
44311197 |
T |
|
| Q |
167 |
cttcctcaaaccagatgcatcta |
189 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44311196 |
cttcctcaaaccagatgcatcta |
44311174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 292 - 373
Target Start/End: Complemental strand, 44311066 - 44310985
Alignment:
| Q |
292 |
aatcaatggtgacaaaagttgtttaaaagattagtgttaatggcaatgaatatgatttccctttaattcttgactgagtatt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311066 |
aatcaatggtgacaaaagttgtttaaaagattagtgttaatggcaatgaatatgatttccctttaattcttgactgagtatt |
44310985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43533876 - 43533818
Alignment:
| Q |
1 |
gtcaatttatatattcaattcaaagttatgtgagtagggttattatttattcattttac |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533876 |
gtcaatttatatattcaattcaaagttatgtgagtagggttattatttattcattttac |
43533818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University