View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4838-Insertion-8 (Length: 119)
Name: NF4838-Insertion-8
Description: NF4838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4838-Insertion-8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 12 - 119
Target Start/End: Complemental strand, 53911794 - 53911687
Alignment:
| Q |
12 |
catgatgtatgtattatatattttgagcatcatattgttgccaatttatagtagcatgatgtattattatagattggaatttagttgaaccattgggtca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53911794 |
catgatgtatgtattatatattttgagcatcatattgttgccaatttatagtagcatgatgtattattatagagtggaatttagttgaaccattgggtca |
53911695 |
T |
|
| Q |
112 |
actttatg |
119 |
Q |
| |
|
|||||||| |
|
|
| T |
53911694 |
actttatg |
53911687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 52964378 - 52964337
Alignment:
| Q |
20 |
atgtattatatattttgagcatcatattgttgccaatttata |
61 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
52964378 |
atgtattatatattttgggcaccatattgttgccaatttata |
52964337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University