View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4839-Insertion-12 (Length: 306)
Name: NF4839-Insertion-12
Description: NF4839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4839-Insertion-12 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 8 - 306
Target Start/End: Complemental strand, 48606408 - 48606110
Alignment:
| Q |
8 |
tttcaagcattggatgattcggggaaggctcgatgtttaggtggtgattattttgagactgatctttcgggggaatcgtggaaatctagaccgttggtga |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48606408 |
tttcaagcattggatgattcgaggaaggctcgatgtttaggtggtgattattttgagactgatctttcgggggaatcgtggaaatctagaccgttggtga |
48606309 |
T |
|
| Q |
108 |
aagattttagcaatggatcttactcgatttcgtttcaagttcatcctgattttgttggggtttataatctcactattttcttgctttatagacagttgga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
48606308 |
aagattttagcaatggatcttactcgatttcgcttcaagttcatcctgattttgttggggtttataatcttactattttcttgctttatagacagttaga |
48606209 |
T |
|
| Q |
208 |
aggtttgaagcttaccccttggaaatatgtttacgaacgaatgggtcgtagtattgcaattagattctacaagaatgaggttttcataccggagttgca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48606208 |
aggtttgaagcttaccccttggaaatatgtttacgaccgaatggttcgtagtattgcaattagattctacaagaatgaggttctcataccggagttgca |
48606110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 306
Target Start/End: Complemental strand, 48612004 - 48611706
Alignment:
| Q |
8 |
tttcaagcattggatgattcggggaaggctcgatgtttaggtggtgattattttgagactgatctttcgggggaatcgtggaaatctagaccgttggtga |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48612004 |
tttcaagcattggatgattcggggaagtctcgatgtttaggtggtgattactttgagactagtctttcgggggaatcgtggaaatctaggccgttggtga |
48611905 |
T |
|
| Q |
108 |
aagattttagcaatggatcttactcgatttcgtttcaagttcatcctgattttgttggggtttataatctcactattttcttgctttatagacagttgga |
207 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| || || |
|
|
| T |
48611904 |
aagattttagtaatggatcttactcgatttcacttcaagttcatcctgattttgttggggtttataatcttactattatcttgctttatagacactttga |
48611805 |
T |
|
| Q |
208 |
aggtttgaagcttaccccttggaaatatgtttacgaacgaatgggtcgtagtattgcaattagattctacaagaatgaggttttcataccggagttgca |
306 |
Q |
| |
|
|||||||||| |||| || |||| || ||||||||| ||||||| |||||||||||||||||||||||| ||| |||| |||| ||||||||| |||| |
|
|
| T |
48611804 |
aggtttgaagtttactccatggagatttgtttacgatcgaatggttcgtagtattgcaattagattctataaggatgatattttgataccggagctgca |
48611706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University