View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4839_low_2 (Length: 302)
Name: NF4839_low_2
Description: NF4839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4839_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 105 - 286
Target Start/End: Complemental strand, 38790124 - 38789936
Alignment:
| Q |
105 |
aatatgatcaatcttttattcaatattgcacatatcctcaattgataatcactatccatact-----gctttcagttagtatgtccaatactgcagtttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
38790124 |
aatatgatcaatcttttattcaatattgcacatatcctcaattgaatatcactatccatactatactgctttcagttagtatgtccaatactacagtttt |
38790025 |
T |
|
| Q |
200 |
gtcgctacat--gcatgtatccagttcatcacaattcacaaatgctcttcgcaactagctctcgttaaatttatgtttggggttgttat |
286 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
38790024 |
gtcgctacatatgcatgtatccagttcatcacaattcacaaatgctcttcgcaactagctctcgttaaatttctgtttggtgttgttat |
38789936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Complemental strand, 38790432 - 38790382
Alignment:
| Q |
5 |
ggtagataattcttatccaattcaatcctcttttccaaaagataaaaataa |
55 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790432 |
ggtatataattcttatccaattcaatcctcttttccaaaagataaaaataa |
38790382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 38790188 - 38790155
Alignment:
| Q |
57 |
actatacaaaaactttcatttttgggtaaataat |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38790188 |
actatacaaaaactttcatttttgggtaaataat |
38790155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University