View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-10 (Length: 388)
Name: NF4840-Insertion-10
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 8 - 388
Target Start/End: Original strand, 40167363 - 40167743
Alignment:
| Q |
8 |
cgtttttcattccatcgggcaaattgttctaaaattcatgatgcccatcacatgctcctcctctatcagaaactccacatttgttggggctagacgattc |
107 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40167363 |
cgtttttcattccgtcaggcaaattgttctaaaatccatgatgcccatcacatgctcctcctctatcagaacctccacatttgttggggctagacgattc |
40167462 |
T |
|
| Q |
108 |
tacctcgactaaagctactagtttaagaagagataccctttgaccaaggaacataaacttgtatgtgatgccaacatatctccaaaaataaaccctgcac |
207 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40167463 |
tacctcgactaaagctactagtttaggatgagataccctttgaccaaggaacataaacttgtatgtgatgccaacatatctccaaaaataaaccccgcac |
40167562 |
T |
|
| Q |
208 |
atcctcgtgtataacatgcnnnnnnnnnntcttgaaatgtgttgtctatctggaatacattaatatctggcatggatgaaggatgcatcagaatgatctg |
307 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40167563 |
atcctcgtgtataacatgcaacaaaaaaatcttgaaatgtgttgtctgtctggaatacattaatatctggcatggatgaaggatgcatcagaatgatctt |
40167662 |
T |
|
| Q |
308 |
agtacattcatatcgtctcatcacccgctctgacaagtggcgagaaaccatcctacaaccacgctttatccaaccagggta |
388 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40167663 |
aatacattcatatcgtctcatcacccgctctgacaggtggcgagaaaccatcctacaaccacgctttatccaaccagggta |
40167743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University