View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-12 (Length: 95)
Name: NF4840-Insertion-12
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 39279595 - 39279665
Alignment:
| Q |
8 |
ttaactatataatattacaaatatttcatggtctctcttagccaatacctgcttataaacttctaggagca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
39279595 |
ttaactatataatattacaaatatttcatggtctgtcttagccaatgccttcttataaacttctaggagca |
39279665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University