View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-13 (Length: 338)
Name: NF4840-Insertion-13
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 338
Target Start/End: Original strand, 17233141 - 17233482
Alignment:
| Q |
8 |
cttctatgcttcgacgctactagaacggtgtccaac-----------actcatatgagccgtgtcggacaactcaggcaaaagtctgaaacatctgtgat |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17233141 |
cttctatgcttcgacactactagaacggtgtccaacacttatacaacactcatatgagccgtgtcggacaactcagataaaagtctgaaacatctgtgat |
17233240 |
T |
|
| Q |
97 |
tcccaacatccttgtgtcatttctttgcggtgggtgttgttgcacatattaggcccttatggggttctcattcttattgcttgcggttgcagttcctatt |
196 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
17233241 |
tcccaacatcctagtgtcatttctttgtggtgggtgttgttgcacatattaggcccttatggggttctcattcttattgcttgcggttgcggttcttatt |
17233340 |
T |
|
| Q |
197 |
catagtgcactcttcactcttgaaaaatttgccagactgctacagagcaacatctgtaaatttctttctagtgttgttatttgagacaataaatacttca |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17233341 |
catagtgcactcttcactcttgaaaaatttgccagactgcttcagagcaacatctgtgaatttctttctagtgttgttatttgagacaataaacacttca |
17233440 |
T |
|
| Q |
297 |
tcatgtttattccaaaggattatttctttaaacttttgatca |
338 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
17233441 |
tattgtttattccaaaggagtatttctttaaacttttaatca |
17233482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 17540284 - 17540248
Alignment:
| Q |
41 |
aacactcatatgagccgtgtcggacaactcaggcaaa |
77 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17540284 |
aacactcatatgaaccgtgtcggacaactcagacaaa |
17540248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 26565567 - 26565531
Alignment:
| Q |
41 |
aacactcatatgagccgtgtcggacaactcaggcaaa |
77 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
26565567 |
aacactcatacgagccgtgtcggacaactcagacaaa |
26565531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University