View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-16 (Length: 286)
Name: NF4840-Insertion-16
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 41444089 - 41444332
Alignment:
| Q |
8 |
ctctgatcggtgagttttcatctactttgctttatcacacattttttaccttttgcttgct-caatcactttatggtgttgagatttgagttttttctgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444089 |
ctctgatcggtgagttttcatctactttgctttatcacacattttttaccttttgcttgctacaatcactttatggtgttgagatttgagttttttctgc |
41444188 |
T |
|
| Q |
107 |
taaactttttgacccatttaaccaaaatgtccttaaagtatgttcaacagcataaagtttgtaaatttgtgttttttgcaaaggttttggaatctgggtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444189 |
taaactttttgacccatttaaccaaaatgtccttaaagtatgttcaacagcataaagtttgtaaatttgtgttttttgcaaaggttttggaatctgggtt |
41444288 |
T |
|
| Q |
207 |
agattgtgatttgggtttagttcttggggtttaagatttatgtc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444289 |
agattgtgatttgggtttagttcttggggtttaagatttatgtc |
41444332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University