View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-18 (Length: 210)
Name: NF4840-Insertion-18
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 205
Target Start/End: Complemental strand, 9857874 - 9857671
Alignment:
| Q |
2 |
cctcttcatcttcatattcttccaaaccaacgttccattgatatcctccgtaatcatcttcataattaacttcataataatcatcttcttcttcaacctc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857874 |
cctcttcatcttcatattcttccaaaccaacgttccattgatatcctccgtaatcatcttcataattaacttcataataatcatcttcttcttcaacctc |
9857775 |
T |
|
| Q |
102 |
catttcctcttcaacttcttcccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatcttcttcaacctccatttcctcttcatct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857774 |
catttcctcttcaacttcttcccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatcttcttcaacctccatttcctcttcatct |
9857675 |
T |
|
| Q |
202 |
tcaa |
205 |
Q |
| |
|
|||| |
|
|
| T |
9857674 |
tcaa |
9857671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 79
Target Start/End: Complemental strand, 9857685 - 9857608
Alignment:
| Q |
2 |
cctcttcatcttcatattcttccaaaccaacgttccattgatatcctccgtaatcatcttcataattaacttcataat |
79 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
9857685 |
cctcttcatcttcaaattcatccaaaccattgttccattgatatcctcggtaatcatcttcaaaataaacttcataat |
9857608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 164
Target Start/End: Complemental strand, 9857753 - 9857610
Alignment:
| Q |
36 |
ccattgatatcctccgtaatcatcttcataattaacttcataataatcatcttcttcttcaacctccatttcctcttcaacttc---ttc---------- |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||| | |||||||||||| ||||||||||||||||||| |||| ||| |
|
|
| T |
9857753 |
ccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatcttcttc---aacctccatttcctcttcatcttcaaattcatccaaacca |
9857657 |
T |
|
| Q |
123 |
-----ccattgatatcctccgtaatcatcttcacaataaacttcata |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
9857656 |
ttgttccattgatatcctcggtaatcatcttcaaaataaacttcata |
9857610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 204
Target Start/End: Complemental strand, 9857892 - 9857861
Alignment:
| Q |
173 |
cttcttcaacctccatttcctcttcatcttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9857892 |
cttcttcaacctccatttcctcttcatcttca |
9857861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University