View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-20 (Length: 89)
Name: NF4840-Insertion-20
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 9e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 9e-33
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 24856927 - 24856849
Alignment:
| Q |
10 |
agtagtgatacactccattgccaattgtctaaagcacaaagttattttacaaaaagctgtaacgatattattttttaag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24856927 |
agtagtgatacactccattgccaattgtctaacgcacaaagttattttacaaaaagcagtaacgatattattttttaag |
24856849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University