View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840-Insertion-9 (Length: 405)
Name: NF4840-Insertion-9
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840-Insertion-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 164 - 288
Target Start/End: Original strand, 48908578 - 48908702
Alignment:
| Q |
164 |
gagggaagagagagtgagcaccgtgatgagaataggagaaaacagctctgtaggtgtagacatgatcgccgggtttgatttcgtgtttctcaattctgtt |
263 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48908578 |
gaggaaagagagagtgagaaccgtgatgagaataggagaaaacagctctgtaggtgtagacatgatcgccgggtttgatgtcgtgtttctcaattctgtt |
48908677 |
T |
|
| Q |
264 |
agaaatcaaacccattcacattcac |
288 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48908678 |
agaaatcaaacccattcacattcac |
48908702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 10 - 135
Target Start/End: Original strand, 48908430 - 48908551
Alignment:
| Q |
10 |
attgtccaagcaacaagaaagtaagcagaaaataataattataattggtcatttgtgagattattaatttatttatgataagttgggatctgatattctg |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
48908430 |
attgtccaagcaacaacaaagtaagcagaaaataataattataattggtcatttgtgagatt----atttatttatgataagttcggatctgatattctg |
48908525 |
T |
|
| Q |
110 |
cattggagggagcaggcaagaaaaac |
135 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48908526 |
cattggagggagcaggcaagaaaaac |
48908551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 48908777 - 48908838
Alignment:
| Q |
344 |
ccttttgtccaccccaccgtttgtctgtgttactgtcactgccacttttcatttcatttcaa |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48908777 |
ccttttgtccaccccaccgtttgtctgtgttactgtcactgccacttttcatttcatttcaa |
48908838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University