View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840_low_2 (Length: 263)
Name: NF4840_low_2
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 258
Target Start/End: Complemental strand, 303868 - 303602
Alignment:
| Q |
6 |
actttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagttttcctgcaaattaacnnnnnnn------------- |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
303868 |
actttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgcaaattaaccatgatcaataaataaaaaa |
303769 |
T |
 |
| Q |
93 |
-tgttcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303768 |
atgttcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtctt |
303669 |
T |
 |
| Q |
192 |
gcaactatcttgagagtcctcttcagatttaatggttaaggaaaagtcttgttccctttgatgatgt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
303668 |
gcaactatcttgagagtcctcttcagatttaatggttaaggaaaagttttgttccctttgatgatgt |
303602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University