View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4840_low_3 (Length: 251)
Name: NF4840_low_3
Description: NF4840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4840_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 42 - 210
Target Start/End: Complemental strand, 11346495 - 11346310
Alignment:
| Q |
42 |
gttaattacctaatttttattcaaggtatgaacgacaattaa----gtgtcttggaccatttttgcaacaaacaataattaactatgttggagagcgaac |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11346495 |
gttaattacctaatttttattcaaggtatgaacaacaattaattaagtgtcttggacaatttttgcaacaaacaataattaactgtgttggagagcgaac |
11346396 |
T |
 |
| Q |
138 |
agcaattaac------------taaataggtcatttttaagtgatt-ataacaattttgtaagtttaaagaacaattttctcactt |
210 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11346395 |
agcaattaactaccgttgaaggtaaataagtaatttttaagtgattgataacaattttgtaagtttaaagaacaattttctcactt |
11346310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 11346737 - 11346700
Alignment:
| Q |
6 |
aaattgatggcaaaattcacataccacgtgatggctgt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11346737 |
aaattgatggcaaaattcacataccacgtgatggctgt |
11346700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University