View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4841-Insertion-2 (Length: 786)

Name: NF4841-Insertion-2
Description: NF4841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4841-Insertion-2
NF4841-Insertion-2
[»] chr5 (210 HSPs)
chr5 (323-625)||(7194609-7194912)
chr5 (43-227)||(18633774-18633960)
chr5 (43-227)||(28550828-28551012)
chr5 (43-227)||(35165973-35166157)
chr5 (43-227)||(36577723-36577906)
chr5 (43-227)||(6118308-6118498)
chr5 (43-227)||(29172524-29172710)
chr5 (43-227)||(35166979-35167164)
chr5 (43-227)||(2217671-2217853)
chr5 (43-227)||(29875401-29875586)
chr5 (43-227)||(29692906-29693089)
chr5 (43-227)||(30800665-30800849)
chr5 (43-227)||(42207243-42207427)
chr5 (43-223)||(5614347-5614529)
chr5 (45-223)||(15635379-15635558)
chr5 (43-227)||(29151517-29151703)
chr5 (43-227)||(30888161-30888347)
chr5 (43-227)||(5950177-5950359)
chr5 (142-227)||(16616463-16616548)
chr5 (142-227)||(27850190-27850275)
chr5 (142-227)||(38962907-38962992)
chr5 (142-227)||(294006-294091)
chr5 (43-227)||(21050576-21050760)
chr5 (43-227)||(38786160-38786343)
chr5 (44-227)||(16038553-16038738)
chr5 (43-227)||(10408929-10409117)
chr5 (142-227)||(7075775-7075860)
chr5 (142-223)||(23382127-23382208)
chr5 (142-227)||(25778975-25779060)
chr5 (142-227)||(31037497-31037582)
chr5 (142-227)||(38496521-38496606)
chr5 (144-227)||(21125087-21125170)
chr5 (43-227)||(33335838-33336025)
chr5 (142-227)||(37090555-37090640)
chr5 (142-223)||(39379330-39379411)
chr5 (43-225)||(4203457-4203637)
chr5 (43-227)||(25561706-25561894)
chr5 (142-227)||(18046165-18046250)
chr5 (43-227)||(34125308-34125491)
chr5 (143-227)||(3850441-3850525)
chr5 (43-223)||(10743873-10744053)
chr5 (143-227)||(27916564-27916648)
chr5 (43-219)||(28863656-28863837)
chr5 (146-227)||(3850638-3850719)
chr5 (142-227)||(14318215-14318300)
chr5 (43-99)||(18633600-18633656)
chr5 (43-99)||(29172829-29172885)
chr5 (43-99)||(29875668-29875724)
chr5 (43-94)||(13990843-13990894)
chr5 (142-225)||(24782092-24782175)
chr5 (43-97)||(2217495-2217549)
chr5 (43-97)||(7075573-7075627)
chr5 (43-97)||(28863511-28863565)
chr5 (43-97)||(29692745-29692799)
chr5 (43-97)||(30800495-30800549)
chr5 (43-97)||(36578028-36578082)
chr5 (43-97)||(40029442-40029496)
chr5 (43-227)||(9179736-9179919)
chr5 (143-227)||(13990708-13990792)
chr5 (43-99)||(15635650-15635706)
chr5 (142-218)||(40029240-40029316)
chr5 (43-94)||(10743725-10743776)
chr5 (43-94)||(16038378-16038429)
chr5 (43-94)||(18046296-18046347)
chr5 (43-97)||(1105093-1105147)
chr5 (43-97)||(1381556-1381610)
chr5 (43-97)||(5917405-5917459)
chr5 (43-97)||(6912498-6912552)
chr5 (43-97)||(11799403-11799457)
chr5 (43-97)||(19565776-19565830)
chr5 (43-97)||(19685325-19685379)
chr5 (43-97)||(24443689-24443743)
chr5 (43-97)||(26133184-26133238)
chr5 (43-97)||(26133358-26133412)
chr5 (43-97)||(35928065-35928119)
chr5 (43-97)||(38170515-38170569)
chr5 (45-99)||(39379242-39379296)
chr5 (43-97)||(40167787-40167841)
chr5 (43-97)||(40764416-40764470)
chr5 (41-94)||(2636941-2636994)
chr5 (43-99)||(10409269-10409325)
chr5 (45-97)||(20985728-20985780)
chr5 (43-99)||(25561942-25561998)
chr5 (43-99)||(29151794-29151850)
chr5 (43-99)||(38496725-38496781)
chr5 (43-99)||(39379553-39379609)
chr5 (43-94)||(293829-293880)
chr5 (43-94)||(20660949-20661000)
chr5 (43-94)||(23382245-23382296)
chr5 (43-97)||(45139-45193)
chr5 (43-97)||(1104859-1104913)
chr5 (43-97)||(1381248-1381302)
chr5 (47-97)||(3850544-3850594)
chr5 (43-97)||(4203715-4203769)
chr5 (43-97)||(5917127-5917181)
chr5 (43-97)||(11799130-11799184)
chr5 (43-97)||(18046039-18046093)
chr5 (43-97)||(19565468-19565522)
chr5 (43-97)||(19685018-19685072)
chr5 (43-97)||(20986034-20986088)
chr5 (43-97)||(21050858-21050912)
chr5 (43-97)||(21124914-21124968)
chr5 (43-97)||(24443381-24443435)
chr5 (43-97)||(24781990-24782044)
chr5 (689-778)||(25992329-25992418)
chr5 (43-97)||(29366894-29366948)
chr5 (43-97)||(34125577-34125631)
chr5 (43-97)||(35876689-35876743)
chr5 (43-97)||(35928403-35928457)
chr5 (43-97)||(37271360-37271414)
chr5 (43-97)||(40764725-40764779)
chr5 (44-97)||(6912802-6912855)
chr5 (45-94)||(9532483-9532532)
chr5 (45-93)||(27916713-27916761)
chr5 (45-97)||(28108107-28108159)
chr5 (143-227)||(29366763-29366847)
chr5 (43-91)||(35166912-35166960)
chr5 (43-94)||(2032888-2032939)
chr5 (43-97)||(3850300-3850355)
chr5 (43-94)||(5614167-5614218)
chr5 (34-97)||(12144899-12144962)
chr5 (43-94)||(14318046-14318097)
chr5 (43-94)||(18258475-18258526)
chr5 (43-94)||(28213374-28213425)
chr5 (43-90)||(31037693-31037740)
chr5 (158-213)||(31602265-31602320)
chr5 (43-97)||(1286683-1286737)
chr5 (43-97)||(4736487-4736541)
chr5 (43-97)||(9179594-9179648)
chr5 (43-97)||(18258163-18258217)
chr5 (43-97)||(20661256-20661310)
chr5 (43-97)||(20683748-20683802)
chr5 (43-93)||(20690734-20690784)
chr5 (143-213)||(22551144-22551214)
chr5 (43-97)||(23381951-23382005)
chr5 (43-97)||(25779107-25779161)
chr5 (689-778)||(26405212-26405301)
chr5 (43-97)||(28871939-28871993)
chr5 (43-97)||(35609304-35609358)
chr5 (43-97)||(35876997-35877051)
chr5 (43-97)||(37271651-37271705)
chr5 (43-97)||(40029142-40029196)
chr5 (43-97)||(40167953-40168007)
chr5 (158-227)||(9532307-9532376)
chr5 (44-93)||(16616370-16616419)
chr5 (43-92)||(18286691-18286740)
chr5 (43-92)||(38962807-38962856)
chr5 (44-97)||(42207518-42207570)
chr5 (44-96)||(27850320-27850372)
chr5 (44-92)||(35609587-35609635)
chr5 (45-97)||(42596762-42596814)
chr5 (53-99)||(6118143-6118190)
chr5 (46-97)||(32888691-32888742)
chr5 (43-90)||(42994069-42994116)
chr5 (43-93)||(2636670-2636720)
chr5 (43-97)||(3851274-3851328)
chr5 (43-97)||(5904009-5904063)
chr5 (151-213)||(17070646-17070708)
chr5 (43-97)||(17070808-17070862)
chr5 (149-191)||(20690840-20690882)
chr5 (43-97)||(36973655-36973709)
chr5 (43-97)||(40038803-40038857)
chr5 (43-93)||(42553643-42553693)
chr5 (689-777)||(7194965-7195053)
chr5 (43-96)||(15916287-15916340)
chr5 (147-208)||(26071397-26071458)
chr5 (44-93)||(31037397-31037446)
chr5 (159-208)||(32108926-32108975)
chr5 (43-96)||(38555030-38555082)
chr5 (159-208)||(40038614-40038663)
chr5 (703-755)||(4914177-4914229)
chr5 (160-208)||(5904205-5904253)
chr5 (142-227)||(11799205-11799286)
chr5 (43-95)||(20416361-20416413)
chr5 (61-97)||(26071561-26071597)
chr5 (45-97)||(28871640-28871692)
chr5 (55-98)||(1105032-1105075)
chr5 (149-208)||(4736374-4736433)
chr5 (55-94)||(9588559-9588598)
chr5 (149-208)||(10830638-10830697)
chr5 (149-208)||(11935802-11935861)
chr5 (159-202)||(28107918-28107961)
chr5 (55-98)||(28213446-28213489)
chr5 (55-98)||(28871711-28871754)
chr5 (42-97)||(29855613-29855668)
chr5 (30-97)||(32108796-32108863)
chr5 (149-204)||(37271542-37271597)
chr5 (43-90)||(40038495-40038542)
chr5 (55-97)||(1286932-1286974)
chr5 (43-97)||(10830530-10830584)
chr5 (44-98)||(12145127-12145181)
chr5 (43-97)||(17070536-17070589)
chr5 (45-95)||(20417963-20418013)
chr5 (149-191)||(20661057-20661099)
chr5 (43-97)||(26071292-26071346)
chr5 (43-97)||(27916462-27916516)
chr5 (158-208)||(28213491-28213541)
chr5 (55-93)||(31602221-31602259)
chr5 (158-208)||(32888798-32888848)
chr5 (44-90)||(38452348-38452394)
chr5 (45-90)||(45456-45501)
chr5 (159-208)||(2636788-2636837)
chr5 (43-92)||(5103951-5104000)
chr5 (159-208)||(9588444-9588493)
chr5 (45-90)||(18286431-18286476)
chr5 (159-204)||(19685135-19685180)
chr5 (44-93)||(20691045-20691094)
chr5 (159-204)||(24443499-24443544)
chr5 (159-208)||(35609392-35609441)
chr5 (43-92)||(36973354-36973403)
[»] chr6 (180 HSPs)
chr6 (43-227)||(33801557-33801742)
chr6 (41-222)||(31166869-31167051)
chr6 (43-227)||(15076018-15076203)
chr6 (43-227)||(8680776-8680962)
chr6 (43-227)||(7155798-7155983)
chr6 (43-226)||(34582530-34582715)
chr6 (43-227)||(32885674-32885859)
chr6 (142-227)||(14655584-14655669)
chr6 (142-227)||(24273939-24274024)
chr6 (43-227)||(15962028-15962214)
chr6 (43-219)||(30928867-30929043)
chr6 (41-227)||(494576-494753)
chr6 (43-226)||(543538-543723)
chr6 (37-227)||(24692795-24692984)
chr6 (43-227)||(317813-317995)
chr6 (142-227)||(2616049-2616134)
chr6 (142-227)||(15116773-15116858)
chr6 (142-227)||(17321368-17321453)
chr6 (142-227)||(17321501-17321586)
chr6 (45-227)||(10091039-10091220)
chr6 (142-227)||(777853-777939)
chr6 (45-227)||(1890062-1890246)
chr6 (45-227)||(3356315-3356495)
chr6 (143-227)||(7324007-7324091)
chr6 (142-220)||(19296227-19296305)
chr6 (142-227)||(11129302-11129387)
chr6 (43-227)||(26375694-26375878)
chr6 (143-227)||(6468486-6468570)
chr6 (143-227)||(19275855-19275939)
chr6 (143-227)||(21995167-21995251)
chr6 (142-212)||(31398370-31398440)
chr6 (143-227)||(6591255-6591339)
chr6 (40-210)||(14428648-14428818)
chr6 (142-227)||(5286687-5286775)
chr6 (143-227)||(2373307-2373391)
chr6 (43-99)||(7156103-7156159)
chr6 (163-227)||(12612172-12612236)
chr6 (43-99)||(24274074-24274130)
chr6 (143-227)||(33131626-33131710)
chr6 (43-97)||(15962334-15962388)
chr6 (46-99)||(543365-543418)
chr6 (43-99)||(1890395-1890451)
chr6 (43-99)||(8681059-8681115)
chr6 (43-99)||(12419881-12419937)
chr6 (43-99)||(14655380-14655436)
chr6 (43-99)||(22822594-22822650)
chr6 (163-227)||(23770336-23770400)
chr6 (33-97)||(25431799-25431863)
chr6 (45-97)||(26375990-26376042)
chr6 (43-94)||(494406-494457)
chr6 (44-99)||(5286894-5286949)
chr6 (176-227)||(22822391-22822442)
chr6 (43-97)||(1007454-1007508)
chr6 (43-97)||(3414388-3414442)
chr6 (43-97)||(3968954-3969008)
chr6 (43-97)||(19296352-19296406)
chr6 (43-97)||(21994348-21994402)
chr6 (43-97)||(21995065-21995119)
chr6 (43-97)||(22543355-22543409)
chr6 (43-97)||(23770162-23770216)
chr6 (43-97)||(25137302-25137356)
chr6 (43-97)||(30928682-30928736)
chr6 (43-97)||(34582837-34582891)
chr6 (43-96)||(2615873-2615926)
chr6 (45-97)||(7324137-7324189)
chr6 (143-227)||(9896453-9896537)
chr6 (161-226)||(11448657-11448726)
chr6 (45-97)||(12176588-12176640)
chr6 (43-95)||(22792846-22792898)
chr6 (43-99)||(31167143-31167199)
chr6 (43-99)||(33808621-33808677)
chr6 (45-97)||(34990260-34990312)
chr6 (43-94)||(3356143-3356194)
chr6 (43-94)||(12419709-12419760)
chr6 (43-94)||(17771912-17771963)
chr6 (43-97)||(1007125-1007179)
chr6 (43-97)||(2373180-2373234)
chr6 (43-97)||(3968646-3968700)
chr6 (43-97)||(6412219-6412273)
chr6 (43-97)||(6412524-6412578)
chr6 (43-97)||(6468311-6468365)
chr6 (43-97)||(10910909-10910963)
chr6 (43-97)||(11449114-11449168)
chr6 (43-97)||(12299085-12299139)
chr6 (43-97)||(12612304-12612358)
chr6 (43-97)||(19690394-19690448)
chr6 (43-97)||(20467663-20467717)
chr6 (43-97)||(21147405-21147459)
chr6 (43-97)||(21385252-21385306)
chr6 (43-97)||(21385529-21385583)
chr6 (43-97)||(21995370-21995424)
chr6 (43-97)||(22543663-22543717)
chr6 (43-97)||(23502485-23502539)
chr6 (43-97)||(24273829-24273883)
chr6 (43-97)||(25136995-25137049)
chr6 (24-97)||(30479367-30479438)
chr6 (43-97)||(31198616-31198670)
chr6 (43-97)||(33131795-33131849)
chr6 (43-96)||(13268110-13268163)
chr6 (44-97)||(13617531-13617584)
chr6 (43-92)||(19321081-19321130)
chr6 (174-223)||(25431672-25431721)
chr6 (43-99)||(777678-777734)
chr6 (43-95)||(11448538-11448590)
chr6 (45-97)||(20467354-20467406)
chr6 (187-227)||(33808797-33808837)
chr6 (42-94)||(34989961-34990013)
chr6 (43-94)||(3276302-3276353)
chr6 (43-94)||(9896585-9896636)
chr6 (54-97)||(13617761-13617804)
chr6 (43-98)||(19129337-19129392)
chr6 (43-97)||(318042-318096)
chr6 (43-89)||(2616193-2616239)
chr6 (43-97)||(3414697-3414751)
chr6 (43-89)||(6591116-6591162)
chr6 (43-93)||(8170100-8170150)
chr6 (43-93)||(12757611-12757661)
chr6 (44-94)||(14428898-14428948)
chr6 (43-97)||(14656205-14656259)
chr6 (43-97)||(18024320-18024374)
chr6 (43-97)||(19267566-19267620)
chr6 (43-97)||(19296109-19296163)
chr6 (43-97)||(21993788-21993842)
chr6 (43-89)||(23502238-23502284)
chr6 (43-93)||(24901240-24901290)
chr6 (43-97)||(31186536-31186590)
chr6 (43-92)||(777992-778041)
chr6 (159-208)||(13617648-13617697)
chr6 (43-92)||(17765010-17765059)
chr6 (43-92)||(22822308-22822357)
chr6 (43-96)||(30239294-30239347)
chr6 (44-92)||(6591392-6591440)
chr6 (142-190)||(17772014-17772062)
chr6 (45-97)||(18024014-18024066)
chr6 (689-729)||(20701461-20701501)
chr6 (43-83)||(23770398-23770438)
chr6 (41-97)||(31276285-31276341)
chr6 (143-227)||(34990129-34990213)
chr6 (45-96)||(12298825-12298876)
chr6 (149-208)||(24901347-24901406)
chr6 (43-94)||(31398489-31398540)
chr6 (43-97)||(10910630-10910684)
chr6 (43-89)||(11129496-11129542)
chr6 (43-97)||(13150695-13150749)
chr6 (43-97)||(19129465-19129519)
chr6 (31-97)||(19275984-19276050)
chr6 (43-97)||(25121441-25121495)
chr6 (43-96)||(1214942-1214995)
chr6 (55-96)||(6564595-6564636)
chr6 (44-97)||(9896280-9896333)
chr6 (43-92)||(15442938-15442987)
chr6 (44-97)||(19320769-19320822)
chr6 (159-208)||(19320886-19320935)
chr6 (159-208)||(31198734-31198783)
chr6 (689-776)||(3880276-3880363)
chr6 (53-93)||(6564893-6564933)
chr6 (55-99)||(19275179-19275223)
chr6 (41-93)||(23628797-23628849)
chr6 (55-98)||(1007197-1007240)
chr6 (55-98)||(1214767-1214810)
chr6 (149-208)||(12298927-12298986)
chr6 (43-78)||(15117004-15117039)
chr6 (55-98)||(25137066-25137109)
chr6 (159-202)||(31185753-31185796)
chr6 (55-98)||(31198688-31198731)
chr6 (43-97)||(1875503-1875557)
chr6 (55-97)||(13268182-13268224)
chr6 (43-97)||(14655904-14655958)
chr6 (43-92)||(15116674-15116721)
chr6 (43-97)||(15722611-15722665)
chr6 (43-97)||(17765320-17765374)
chr6 (55-97)||(19129405-19129447)
chr6 (158-208)||(23628994-23629044)
chr6 (55-97)||(24901311-24901353)
chr6 (43-96)||(1214697-1214750)
chr6 (159-204)||(3968764-3968809)
chr6 (62-99)||(5286606-5286643)
chr6 (43-92)||(12611996-12612045)
chr6 (149-186)||(13268218-13268255)
chr6 (55-96)||(17765261-17765302)
[»] chr2 (217 HSPs)
chr2 (43-227)||(38980067-38980252)
chr2 (43-227)||(37271916-37272101)
chr2 (43-227)||(26814042-26814228)
chr2 (43-227)||(19183783-19183969)
chr2 (43-227)||(23989839-23990022)
chr2 (40-227)||(3838077-3838266)
chr2 (43-227)||(38731830-38732013)
chr2 (142-227)||(24483632-24483717)
chr2 (44-227)||(44985623-44985807)
chr2 (43-227)||(11713658-11713844)
chr2 (32-227)||(26707863-26708057)
chr2 (43-227)||(40301976-40302162)
chr2 (43-227)||(43789005-43789191)
chr2 (41-227)||(24483399-24483584)
chr2 (43-227)||(17541590-17541775)
chr2 (43-223)||(33732863-33733041)
chr2 (43-227)||(7814553-7814736)
chr2 (43-227)||(44073620-44073806)
chr2 (43-224)||(20658062-20658242)
chr2 (142-227)||(8046430-8046515)
chr2 (142-227)||(16899996-16900081)
chr2 (142-227)||(16993387-16993472)
chr2 (142-227)||(43710480-43710565)
chr2 (43-227)||(5790714-5790898)
chr2 (60-227)||(22881784-22881950)
chr2 (142-227)||(7814420-7814505)
chr2 (142-227)||(40786561-40786646)
chr2 (142-227)||(41693816-41693901)
chr2 (43-227)||(43597315-43597498)
chr2 (45-223)||(26238816-26238994)
chr2 (142-226)||(41791119-41791203)
chr2 (44-227)||(1497758-1497943)
chr2 (43-223)||(10664985-10665165)
chr2 (142-227)||(14392944-14393029)
chr2 (142-224)||(31225817-31225898)
chr2 (142-227)||(12835427-12835511)
chr2 (45-227)||(17912452-17912636)
chr2 (142-227)||(25954240-25954325)
chr2 (43-227)||(29865326-29865510)
chr2 (43-227)||(32691314-32691498)
chr2 (143-227)||(45442415-45442499)
chr2 (142-227)||(19831609-19831694)
chr2 (142-227)||(43592146-43592231)
chr2 (43-227)||(10374891-10375068)
chr2 (43-99)||(16900149-16900205)
chr2 (43-99)||(16993540-16993596)
chr2 (43-99)||(19184094-19184150)
chr2 (43-99)||(37271740-37271796)
chr2 (43-97)||(24483836-24483890)
chr2 (43-99)||(5790559-5790615)
chr2 (43-99)||(17541383-17541439)
chr2 (43-99)||(26813867-26813923)
chr2 (143-227)||(31326066-31326149)
chr2 (45-97)||(42358702-42358754)
chr2 (43-99)||(43788859-43788915)
chr2 (43-94)||(22881614-22881665)
chr2 (43-97)||(2481502-2481556)
chr2 (47-97)||(3671137-3671187)
chr2 (43-97)||(4423896-4423950)
chr2 (43-97)||(5334752-5334806)
chr2 (43-97)||(5334985-5335039)
chr2 (43-97)||(8046330-8046384)
chr2 (43-97)||(8046593-8046647)
chr2 (43-97)||(9195151-9195205)
chr2 (43-97)||(10374775-10374829)
chr2 (43-97)||(11713486-11713540)
chr2 (43-97)||(11788361-11788415)
chr2 (43-97)||(14003687-14003741)
chr2 (43-97)||(15842768-15842822)
chr2 (43-97)||(16522992-16523046)
chr2 (43-97)||(16523270-16523324)
chr2 (43-97)||(20131626-20131680)
chr2 (43-97)||(24358617-24358671)
chr2 (43-97)||(25705394-25705448)
chr2 (43-97)||(29859817-29859871)
chr2 (43-97)||(29865222-29865276)
chr2 (43-97)||(36622251-36622305)
chr2 (43-128)||(38639413-38639498)
chr2 (43-97)||(40302284-40302338)
chr2 (43-97)||(41693948-41694002)
chr2 (43-97)||(43592047-43592101)
chr2 (43-97)||(43597155-43597209)
chr2 (44-97)||(146328-146381)
chr2 (43-96)||(27311015-27311068)
chr2 (43-96)||(33733187-33733240)
chr2 (43-99)||(7814247-7814303)
chr2 (45-97)||(15842464-15842516)
chr2 (45-97)||(29859490-29859542)
chr2 (43-94)||(10671889-10671940)
chr2 (38-97)||(13215056-13215115)
chr2 (43-97)||(1497611-1497665)
chr2 (43-97)||(3671004-3671058)
chr2 (43-97)||(4424130-4424184)
chr2 (43-97)||(9195055-9195109)
chr2 (43-97)||(12835326-12835380)
chr2 (43-97)||(14003410-14003464)
chr2 (43-97)||(16673716-16673770)
chr2 (45-99)||(17912754-17912808)
chr2 (43-97)||(18113090-18113144)
chr2 (43-97)||(20131318-20131372)
chr2 (43-97)||(20939270-20939324)
chr2 (43-97)||(24358890-24358944)
chr2 (43-97)||(25705086-25705140)
chr2 (43-97)||(26239105-26239159)
chr2 (43-97)||(27310877-27310930)
chr2 (43-97)||(30215423-30215477)
chr2 (43-97)||(31226022-31226076)
chr2 (43-97)||(33576062-33576116)
chr2 (43-97)||(34317799-34317853)
chr2 (43-97)||(41451838-41451892)
chr2 (43-97)||(41693675-41693729)
chr2 (43-97)||(44559063-44559117)
chr2 (43-97)||(44985929-44985983)
chr2 (44-97)||(1137983-1138036)
chr2 (43-96)||(27109074-27109127)
chr2 (44-97)||(41791020-41791073)
chr2 (43-96)||(42695869-42695922)
chr2 (41-94)||(42696151-42696204)
chr2 (45-97)||(16968555-16968607)
chr2 (45-97)||(25954371-25954423)
chr2 (44-92)||(36622534-36622582)
chr2 (143-219)||(44993881-44993957)
chr2 (43-94)||(4042611-4042662)
chr2 (46-97)||(36806841-36806892)
chr2 (43-97)||(146635-146689)
chr2 (43-97)||(2265342-2265396)
chr2 (43-97)||(3837934-3837988)
chr2 (43-97)||(4794131-4794185)
chr2 (43-97)||(10671631-10671685)
chr2 (689-778)||(13337578-13337667)
chr2 (43-97)||(16673412-16673466)
chr2 (43-97)||(17302088-17302142)
chr2 (43-97)||(31225716-31225770)
chr2 (43-97)||(31325921-31325975)
chr2 (43-97)||(31326197-31326251)
chr2 (43-93)||(31644842-31644892)
chr2 (43-97)||(32476096-32476150)
chr2 (43-97)||(33575753-33575807)
chr2 (48-94)||(35155298-35155344)
chr2 (43-97)||(37911065-37911119)
chr2 (43-97)||(40124967-40125021)
chr2 (43-97)||(40786461-40786515)
chr2 (43-93)||(41791261-41791311)
chr2 (43-97)||(43710653-43710707)
chr2 (43-99)||(38979890-38979947)
chr2 (689-742)||(42802450-42802503)
chr2 (44-93)||(44559358-44559407)
chr2 (45-93)||(23990145-23990193)
chr2 (143-227)||(36622349-36622432)
chr2 (43-94)||(3172021-3172072)
chr2 (43-94)||(3172480-3172531)
chr2 (43-94)||(4042838-4042889)
chr2 (55-90)||(16900100-16900135)
chr2 (55-90)||(16993491-16993526)
chr2 (149-208)||(20939157-20939216)
chr2 (149-208)||(23732161-23732220)
chr2 (43-94)||(25954116-25954167)
chr2 (43-94)||(34318031-34318082)
chr2 (43-94)||(45442644-45442695)
chr2 (43-97)||(1138304-1138358)
chr2 (43-97)||(2481194-2481248)
chr2 (43-97)||(10665239-10665293)
chr2 (43-97)||(18113399-18113453)
chr2 (43-97)||(23732274-23732327)
chr2 (43-97)||(30215816-30215870)
chr2 (43-93)||(31909428-31909477)
chr2 (43-97)||(34964104-34964158)
chr2 (43-97)||(36815780-36815834)
chr2 (43-93)||(37228734-37228784)
chr2 (43-97)||(40125234-40125288)
chr2 (43-97)||(43671935-43671989)
chr2 (43-93)||(44994010-44994060)
chr2 (149-202)||(1138091-1138144)
chr2 (159-208)||(4424014-4424063)
chr2 (43-96)||(4842865-4842918)
chr2 (159-208)||(16523108-16523157)
chr2 (149-202)||(25750804-25750857)
chr2 (159-208)||(27109161-27109210)
chr2 (53-98)||(33576030-33576075)
chr2 (159-208)||(40125085-40125134)
chr2 (55-96)||(43710394-43710435)
chr2 (45-93)||(3832586-3832634)
chr2 (45-93)||(13850833-13850881)
chr2 (689-757)||(33788289-33788357)
chr2 (55-98)||(4423968-4424011)
chr2 (55-98)||(4794203-4794246)
chr2 (149-208)||(4842940-4842999)
chr2 (55-98)||(16523062-16523105)
chr2 (43-94)||(23732040-23732091)
chr2 (62-97)||(26708149-26708184)
chr2 (38-93)||(26709692-26709747)
chr2 (149-208)||(31909311-31909370)
chr2 (296-331)||(33733217-33733252)
chr2 (689-752)||(34230555-34230617)
chr2 (149-208)||(43672041-43672100)
chr2 (43-90)||(45442317-45442364)
chr2 (158-208)||(3832389-3832439)
chr2 (47-93)||(4794422-4794468)
chr2 (296-326)||(5790875-5790905)
chr2 (43-89)||(13215318-13215364)
chr2 (56-94)||(14393077-14393115)
chr2 (43-89)||(20658362-20658408)
chr2 (55-89)||(29831885-29831919)
chr2 (158-208)||(34317916-34317966)
chr2 (43-97)||(35155564-35155618)
chr2 (158-208)||(35686173-35686223)
chr2 (43-97)||(37910757-37910811)
chr2 (55-97)||(38732078-38732120)
chr2 (689-778)||(41113404-41113494)
chr2 (43-97)||(43672263-43672317)
chr2 (159-204)||(2481312-2481357)
chr2 (689-781)||(4975069-4975162)
chr2 (689-781)||(4992977-4993070)
chr2 (159-208)||(10671749-10671798)
chr2 (44-97)||(25299747-25299800)
chr2 (159-204)||(41451956-41452001)
chr2 (44-97)||(44993806-44993858)
[»] chr1 (253 HSPs)
chr1 (43-227)||(18473273-18473458)
chr1 (43-227)||(32728863-32729048)
chr1 (43-227)||(7001710-7001896)
chr1 (43-227)||(14007490-14007673)
chr1 (43-227)||(31258340-31258526)
chr1 (43-227)||(12361012-12361197)
chr1 (43-227)||(41358477-41358662)
chr1 (43-227)||(3679627-3679810)
chr1 (43-227)||(19622656-19622842)
chr1 (43-227)||(26061957-26062143)
chr1 (43-227)||(45290458-45290643)
chr1 (43-227)||(22919685-22919868)
chr1 (43-224)||(48955882-48956065)
chr1 (43-227)||(41881094-41881280)
chr1 (43-227)||(24649351-24649536)
chr1 (43-227)||(13259989-13260172)
chr1 (43-227)||(33379889-33380073)
chr1 (43-223)||(35307928-35308110)
chr1 (43-210)||(990089-990256)
chr1 (41-227)||(4323827-4324015)
chr1 (43-227)||(32454104-32454293)
chr1 (142-227)||(2733285-2733370)
chr1 (43-227)||(21383105-21383288)
chr1 (142-227)||(21391192-21391276)
chr1 (43-227)||(26191360-26191544)
chr1 (142-227)||(32626707-32626792)
chr1 (143-227)||(18302197-18302281)
chr1 (43-210)||(44641266-44641431)
chr1 (43-227)||(29688246-29688427)
chr1 (45-226)||(18899950-18900130)
chr1 (142-227)||(10552127-10552212)
chr1 (142-227)||(17984510-17984595)
chr1 (147-227)||(35005491-35005571)
chr1 (43-227)||(13770490-13770675)
chr1 (142-227)||(1159654-1159739)
chr1 (142-227)||(34383047-34383132)
chr1 (43-227)||(52254184-52254367)
chr1 (45-211)||(15335124-15335292)
chr1 (43-227)||(50429024-50429208)
chr1 (143-224)||(4360370-4360451)
chr1 (142-227)||(7818916-7819001)
chr1 (43-219)||(11822005-11822181)
chr1 (43-227)||(26442714-26442898)
chr1 (143-227)||(46868329-46868413)
chr1 (35-227)||(3753206-3753397)
chr1 (142-227)||(1811085-1811170)
chr1 (142-227)||(20756120-20756205)
chr1 (166-227)||(49226361-49226422)
chr1 (143-223)||(16083154-16083234)
chr1 (43-227)||(29072498-29072684)
chr1 (143-227)||(34808296-34808380)
chr1 (143-227)||(48609409-48609493)
chr1 (43-99)||(990322-990378)
chr1 (41-225)||(27521575-27521760)
chr1 (143-227)||(37545766-37545850)
chr1 (43-99)||(41358370-41358426)
chr1 (41-96)||(44641077-44641132)
chr1 (43-97)||(1810928-1810982)
chr1 (43-97)||(18302332-18302386)
chr1 (43-128)||(19622931-19623016)
chr1 (143-213)||(33067559-33067629)
chr1 (43-97)||(45368491-45368545)
chr1 (43-96)||(18473541-18473594)
chr1 (144-224)||(22953374-22953454)
chr1 (163-227)||(39303810-39303874)
chr1 (43-99)||(45290763-45290819)
chr1 (43-94)||(35005692-35005743)
chr1 (43-97)||(3753517-3753571)
chr1 (43-97)||(6567441-6567495)
chr1 (43-97)||(13260266-13260320)
chr1 (43-97)||(21391097-21391151)
chr1 (43-97)||(24507788-24507842)
chr1 (43-97)||(24653803-24653857)
chr1 (142-225)||(26142521-26142596)
chr1 (43-97)||(29072807-29072861)
chr1 (45-99)||(31258645-31258699)
chr1 (43-97)||(33045635-33045689)
chr1 (43-97)||(35005445-35005499)
chr1 (43-97)||(35307716-35307770)
chr1 (43-97)||(37545629-37545683)
chr1 (43-97)||(38151157-38151211)
chr1 (43-97)||(38164240-38164294)
chr1 (43-97)||(44157696-44157750)
chr1 (43-97)||(47819233-47819287)
chr1 (43-97)||(47819541-47819595)
chr1 (43-97)||(50799131-50799185)
chr1 (43-97)||(52254424-52254478)
chr1 (45-97)||(3247507-3247559)
chr1 (45-97)||(38163934-38163986)
chr1 (46-97)||(24649605-24649656)
chr1 (43-94)||(26191682-26191733)
chr1 (43-94)||(26442564-26442615)
chr1 (44-218)||(45368674-45368847)
chr1 (43-98)||(46868521-46868576)
chr1 (47-97)||(2939934-2939984)
chr1 (43-97)||(3247199-3247253)
chr1 (43-97)||(3679931-3679985)
chr1 (42-92)||(7818782-7818832)
chr1 (43-97)||(8140435-8140489)
chr1 (43-97)||(8140744-8140798)
chr1 (43-97)||(10631165-10631219)
chr1 (43-97)||(10631473-10631527)
chr1 (43-97)||(11822310-11822364)
chr1 (43-97)||(12158691-12158745)
chr1 (43-97)||(12360913-12360967)
chr1 (43-97)||(15516583-15516637)
chr1 (43-97)||(15526307-15526361)
chr1 (43-97)||(16026883-16026937)
chr1 (43-97)||(16060830-16060884)
chr1 (43-93)||(17984334-17984384)
chr1 (43-93)||(17984650-17984700)
chr1 (43-97)||(18079399-18079453)
chr1 (43-97)||(19720713-19720767)
chr1 (43-97)||(24507480-24507534)
chr1 (43-97)||(24977779-24977833)
chr1 (43-97)||(26324586-26324640)
chr1 (31-93)||(26324896-26324958)
chr1 (43-97)||(30322930-30322984)
chr1 (43-97)||(30323238-30323292)
chr1 (43-97)||(32626530-32626584)
chr1 (43-97)||(33000306-33000360)
chr1 (43-97)||(33000614-33000668)
chr1 (43-97)||(33234547-33234601)
chr1 (43-97)||(34002885-34002939)
chr1 (43-97)||(35056531-35056585)
chr1 (43-97)||(35056839-35056893)
chr1 (43-97)||(38136926-38136980)
chr1 (43-97)||(39303675-39303729)
chr1 (43-97)||(39747780-39747834)
chr1 (43-97)||(40718111-40718165)
chr1 (43-97)||(45380273-45380327)
chr1 (43-97)||(45380581-45380635)
chr1 (43-97)||(45638581-45638635)
chr1 (43-97)||(48609237-48609291)
chr1 (43-93)||(48609543-48609593)
chr1 (43-93)||(48955715-48955765)
chr1 (44-97)||(4789310-4789363)
chr1 (43-96)||(10887544-10887597)
chr1 (43-96)||(44157988-44158041)
chr1 (45-97)||(18899842-18899894)
chr1 (45-97)||(19721019-19721071)
chr1 (43-91)||(22953507-22953555)
chr1 (41-97)||(32420097-32420153)
chr1 (45-97)||(34808200-34808252)
chr1 (45-97)||(38150851-38150903)
chr1 (149-213)||(48730445-48730509)
chr1 (53-96)||(292870-292913)
chr1 (43-94)||(15058419-15058470)
chr1 (158-213)||(18079517-18079572)
chr1 (43-94)||(22919925-22919976)
chr1 (43-94)||(37624747-37624798)
chr1 (44-95)||(46183686-46183737)
chr1 (43-97)||(7819048-7819102)
chr1 (43-97)||(7867130-7867184)
chr1 (689-778)||(9313004-9313093)
chr1 (43-97)||(10887234-10887288)
chr1 (43-97)||(12322915-12322969)
chr1 (35-97)||(17129682-17129744)
chr1 (43-97)||(24654112-24654166)
chr1 (648-777)||(27102511-27102633)
chr1 (43-97)||(31060788-31060842)
chr1 (43-97)||(33045356-33045410)
chr1 (43-97)||(33234857-33234911)
chr1 (43-97)||(41738797-41738851)
chr1 (45-94)||(7350426-7350475)
chr1 (43-84)||(18079618-18079659)
chr1 (44-97)||(26207280-26207333)
chr1 (43-96)||(39025328-39025380)
chr1 (45-97)||(5058937-5058989)
chr1 (45-97)||(21391319-21391371)
chr1 (43-97)||(41739068-41739119)
chr1 (153-208)||(18927890-18927945)
chr1 (153-208)||(19198781-19198836)
chr1 (149-208)||(24510051-24510110)
chr1 (43-94)||(33067349-33067400)
chr1 (43-90)||(45638846-45638893)
chr1 (43-97)||(4360571-4360625)
chr1 (43-97)||(7867302-7867356)
chr1 (43-97)||(12360604-12360658)
chr1 (43-93)||(15211512-15211562)
chr1 (43-97)||(15211803-15211857)
chr1 (43-93)||(16060597-16060646)
chr1 (43-93)||(16083048-16083098)
chr1 (47-93)||(16083348-16083394)
chr1 (44-90)||(17130035-17130081)
chr1 (59-97)||(18302070-18302108)
chr1 (43-97)||(20948756-20948810)
chr1 (43-97)||(25658015-25658069)
chr1 (45-99)||(26062201-26062255)
chr1 (43-97)||(31061096-31061150)
chr1 (40-90)||(33067682-33067732)
chr1 (43-93)||(34382948-34382997)
chr1 (43-97)||(40718419-40718473)
chr1 (43-93)||(42482980-42483030)
chr1 (44-94)||(48730565-48730615)
chr1 (43-97)||(50428874-50428928)
chr1 (45-94)||(7350684-7350733)
chr1 (149-202)||(8364814-8364867)
chr1 (159-208)||(10887352-10887401)
chr1 (55-96)||(16026586-16026627)
chr1 (159-208)||(16060714-16060763)
chr1 (159-208)||(24977898-24977947)
chr1 (40-93)||(37624976-37625029)
chr1 (43-96)||(49073692-49073745)
chr1 (41-97)||(19198894-19198950)
chr1 (61-97)||(25658246-25658282)
chr1 (43-94)||(33380204-33380256)
chr1 (149-208)||(4789417-4789476)
chr1 (55-98)||(7350620-7350663)
chr1 (55-98)||(10887306-10887349)
chr1 (153-208)||(12322718-12322773)
chr1 (149-208)||(12360712-12360771)
chr1 (149-208)||(17129916-17129975)
chr1 (55-98)||(46183757-46183800)
chr1 (38-97)||(49923763-49923822)
chr1 (43-97)||(1159784-1159838)
chr1 (43-97)||(4565281-4565335)
chr1 (43-97)||(8364861-8364915)
chr1 (158-208)||(15466250-15466300)
chr1 (41-95)||(18928089-18928143)
chr1 (43-97)||(21383373-21383427)
chr1 (43-93)||(22674204-22674254)
chr1 (43-97)||(24978067-24978121)
chr1 (43-93)||(26142421-26142471)
chr1 (42-84)||(26142630-26142672)
chr1 (55-97)||(26324832-26324874)
chr1 (55-89)||(28507188-28507222)
chr1 (43-97)||(28507403-28507457)
chr1 (158-208)||(34002693-34002743)
chr1 (43-97)||(39747475-39747528)
chr1 (158-208)||(41738914-41738964)
chr1 (158-204)||(42483167-42483213)
chr1 (43-89)||(42483224-42483270)
chr1 (55-93)||(46868239-46868277)
chr1 (149-191)||(49073902-49073944)
chr1 (689-726)||(7451925-7451962)
chr1 (296-325)||(10551991-10552020)
chr1 (43-92)||(15058716-15058765)
chr1 (159-204)||(16026774-16026819)
chr1 (43-92)||(24510258-24510307)
chr1 (296-325)||(24649345-24649374)
chr1 (44-97)||(29579322-29579375)
chr1 (151-188)||(32420208-32420245)
chr1 (159-204)||(33000505-33000550)
chr1 (159-208)||(33045475-33045524)
chr1 (43-84)||(36912854-36912895)
chr1 (60-97)||(37646760-37646797)
chr1 (159-204)||(38150967-38151012)
chr1 (689-765)||(38544380-38544457)
chr1 (45-94)||(39025112-39025161)
chr1 (159-208)||(39747592-39747641)
chr1 (159-208)||(44157874-44157923)
chr1 (163-208)||(46183812-46183857)
[»] scaffold0370 (1 HSPs)
scaffold0370 (43-227)||(103-288)
[»] chr4 (258 HSPs)
chr4 (43-227)||(50714379-50714564)
chr4 (43-227)||(6827687-6827873)
chr4 (45-227)||(38054549-38054731)
chr4 (43-227)||(51708841-51709026)
chr4 (43-227)||(32208543-32208727)
chr4 (43-227)||(35415300-35415486)
chr4 (43-227)||(13479273-13479456)
chr4 (43-227)||(41620069-41620255)
chr4 (43-225)||(16712509-16712690)
chr4 (43-225)||(55482286-55482467)
chr4 (142-227)||(4279148-4279233)
chr4 (142-227)||(34355065-34355150)
chr4 (43-226)||(36702001-36702185)
chr4 (43-223)||(52017687-52017869)
chr4 (47-225)||(27008223-27008401)
chr4 (45-223)||(51545788-51545966)
chr4 (43-227)||(29463727-29463912)
chr4 (142-224)||(34361962-34362044)
chr4 (43-223)||(41346036-41346217)
chr4 (43-227)||(41920898-41921083)
chr4 (43-227)||(18205157-18205341)
chr4 (142-227)||(27427944-27428029)
chr4 (43-227)||(9446138-9446322)
chr4 (43-219)||(13064160-13064335)
chr4 (142-227)||(24474776-24474861)
chr4 (43-227)||(35763768-35763954)
chr4 (43-227)||(9289267-9289449)
chr4 (142-225)||(18135931-18136014)
chr4 (142-225)||(49123139-49123222)
chr4 (43-227)||(22584424-22584606)
chr4 (43-227)||(32365095-32365280)
chr4 (142-227)||(46087860-46087943)
chr4 (142-227)||(123708-123793)
chr4 (143-223)||(55072492-55072572)
chr4 (142-225)||(5063105-5063188)
chr4 (43-227)||(45505706-45505893)
chr4 (161-227)||(50822112-50822178)
chr4 (43-227)||(45593229-45593411)
chr4 (43-210)||(53717004-53717173)
chr4 (142-224)||(3178784-3178866)
chr4 (142-227)||(18830946-18831031)
chr4 (143-227)||(2180387-2180471)
chr4 (143-222)||(22099730-22099809)
chr4 (43-99)||(35415576-35415632)
chr4 (43-99)||(35763648-35763704)
chr4 (43-99)||(41345854-41345910)
chr4 (43-97)||(13064410-13064464)
chr4 (45-99)||(15555506-15555560)
chr4 (45-99)||(41619902-41619956)
chr4 (43-97)||(52017506-52017560)
chr4 (43-223)||(52441764-52441942)
chr4 (158-227)||(52429829-52429898)
chr4 (43-99)||(123535-123591)
chr4 (43-99)||(50714241-50714297)
chr4 (38-97)||(13479556-13479615)
chr4 (43-94)||(22099544-22099595)
chr4 (33-96)||(29420483-29420546)
chr4 (43-98)||(46088004-46088059)
chr4 (43-97)||(2034800-2034854)
chr4 (43-97)||(2180221-2180275)
chr4 (43-97)||(11285504-11285558)
chr4 (43-97)||(13530658-13530712)
chr4 (43-97)||(23245232-23245286)
chr4 (43-97)||(24774046-24774100)
chr4 (43-97)||(27008085-27008139)
chr4 (43-97)||(29499183-29499237)
chr4 (43-97)||(30046737-30046791)
chr4 (43-97)||(30061078-30061132)
chr4 (43-97)||(32365428-32365482)
chr4 (43-97)||(35464327-35464381)
chr4 (43-97)||(36054095-36054149)
chr4 (43-97)||(42848336-42848390)
chr4 (43-97)||(43231334-43231388)
chr4 (43-97)||(45505601-45505655)
chr4 (43-97)||(46115415-46115469)
chr4 (43-97)||(46128549-46128603)
chr4 (43-97)||(55072390-55072444)
chr4 (44-97)||(9445951-9446004)
chr4 (43-92)||(23778965-23779014)
chr4 (43-96)||(24474909-24474962)
chr4 (43-96)||(28809126-28809179)
chr4 (44-227)||(43368467-43368651)
chr4 (43-99)||(6827547-6827603)
chr4 (47-99)||(9289582-9289634)
chr4 (45-97)||(29499491-29499543)
chr4 (43-99)||(51708694-51708750)
chr4 (45-97)||(55072657-55072709)
chr4 (43-98)||(4211562-4211617)
chr4 (43-94)||(5052532-5052583)
chr4 (42-97)||(6353583-6353638)
chr4 (43-94)||(29380858-29380909)
chr4 (43-94)||(34361804-34361855)
chr4 (42-97)||(36702308-36702363)
chr4 (43-97)||(5827918-5827972)
chr4 (43-97)||(5882553-5882606)
chr4 (43-97)||(8191336-8191390)
chr4 (43-97)||(8760726-8760780)
chr4 (43-97)||(12791919-12791973)
chr4 (43-97)||(13073760-13073814)
chr4 (43-97)||(13631229-13631283)
chr4 (43-97)||(13631544-13631598)
chr4 (43-97)||(14487803-14487857)
chr4 (43-97)||(14791751-14791805)
chr4 (43-97)||(22099857-22099911)
chr4 (43-97)||(25423925-25423979)
chr4 (43-97)||(25424257-25424311)
chr4 (43-97)||(26412529-26412583)
chr4 (43-97)||(35464019-35464073)
chr4 (43-97)||(43231089-43231143)
chr4 (43-97)||(46115724-46115778)
chr4 (43-97)||(46128858-46128912)
chr4 (43-97)||(46292393-46292447)
chr4 (43-93)||(46292600-46292650)
chr4 (43-93)||(51545630-51545680)
chr4 (43-97)||(52430045-52430099)
chr4 (43-97)||(52442037-52442091)
chr4 (43-97)||(53915684-53915738)
chr4 (31-97)||(53915992-53916058)
chr4 (43-97)||(54903420-54903474)
chr4 (44-97)||(18205468-18205521)
chr4 (36-97)||(23245540-23245601)
chr4 (36-93)||(28448828-28448885)
chr4 (43-96)||(32208847-32208900)
chr4 (143-227)||(11285605-11285689)
chr4 (41-93)||(15555587-15555639)
chr4 (45-97)||(30060772-30060824)
chr4 (42-97)||(2322093-2322148)
chr4 (43-94)||(4279283-4279334)
chr4 (149-208)||(11692870-11692929)
chr4 (38-97)||(12152438-12152497)
chr4 (43-94)||(13074073-13074124)
chr4 (43-98)||(29380669-29380724)
chr4 (142-213)||(29420365-29420436)
chr4 (43-94)||(53716922-53716973)
chr4 (55-97)||(2034552-2034594)
chr4 (43-97)||(4279023-4279077)
chr4 (43-97)||(5827656-5827710)
chr4 (43-97)||(8760605-8760659)
chr4 (43-97)||(11693066-11693120)
chr4 (43-97)||(13764614-13764668)
chr4 (43-97)||(14488132-14488186)
chr4 (43-97)||(19321804-19321858)
chr4 (44-94)||(19903603-19903653)
chr4 (43-93)||(20291987-20292037)
chr4 (43-93)||(22584288-22584338)
chr4 (43-97)||(23779170-23779224)
chr4 (43-97)||(26412191-26412245)
chr4 (43-97)||(27427873-27427926)
chr4 (43-97)||(28809012-28809066)
chr4 (43-97)||(31560332-31560386)
chr4 (43-97)||(31560640-31560694)
chr4 (43-97)||(31812158-31812212)
chr4 (43-97)||(34355228-34355282)
chr4 (43-97)||(35119293-35119347)
chr4 (43-97)||(36050289-36050343)
chr4 (43-97)||(37557140-37557194)
chr4 (43-97)||(41324835-41324889)
chr4 (43-97)||(42848028-42848082)
chr4 (43-97)||(44925790-44925844)
chr4 (43-93)||(45474545-45474595)
chr4 (43-97)||(45593531-45593585)
chr4 (689-766)||(48098645-48098723)
chr4 (43-97)||(53308013-53308067)
chr4 (47-99)||(123840-123893)
chr4 (149-202)||(7642491-7642544)
chr4 (44-93)||(16712331-16712380)
chr4 (44-97)||(18831123-18831176)
chr4 (44-97)||(30564835-30564888)
chr4 (45-96)||(5202929-5202981)
chr4 (45-93)||(14791502-14791550)
chr4 (45-97)||(20144423-20144475)
chr4 (149-213)||(25358396-25358460)
chr4 (45-93)||(54208774-54208822)
chr4 (43-94)||(2180520-2180571)
chr4 (149-208)||(5797652-5797711)
chr4 (43-90)||(8904887-8904934)
chr4 (149-208)||(13530488-13530547)
chr4 (43-94)||(24474601-24474651)
chr4 (149-208)||(25424144-25424203)
chr4 (43-90)||(29463611-29463658)
chr4 (55-98)||(36050359-36050402)
chr4 (38-97)||(37556837-37556896)
chr4 (45-96)||(47022743-47022794)
chr4 (43-94)||(47136119-47136170)
chr4 (58-97)||(54208477-54208516)
chr4 (43-97)||(2322377-2322431)
chr4 (149-191)||(5827764-5827806)
chr4 (43-97)||(12152155-12152209)
chr4 (43-97)||(13530380-13530434)
chr4 (43-97)||(18136058-18136112)
chr4 (43-97)||(19321571-19321625)
chr4 (43-97)||(25358485-25358539)
chr4 (43-97)||(26314277-26314331)
chr4 (43-97)||(31182449-31182503)
chr4 (43-97)||(31811926-31811980)
chr4 (689-766)||(42719495-42719573)
chr4 (43-97)||(42823777-42823831)
chr4 (43-93)||(44925486-44925536)
chr4 (43-97)||(47023050-47023104)
chr4 (43-97)||(49123266-49123320)
chr4 (43-97)||(51738138-51738192)
chr4 (43-97)||(51738356-51738410)
chr4 (43-97)||(51763147-51763201)
chr4 (43-96)||(11692763-11692816)
chr4 (159-208)||(24774259-24774308)
chr4 (43-92)||(31370805-31370854)
chr4 (44-97)||(35420393-35420446)
chr4 (44-97)||(35420648-35420701)
chr4 (159-204)||(47135897-47135942)
chr4 (43-92)||(47274180-47274229)
chr4 (149-202)||(51738309-51738362)
chr4 (44-97)||(51830891-51830944)
chr4 (159-208)||(54208657-54208706)
chr4 (45-97)||(5797484-5797536)
chr4 (45-97)||(5797765-5797817)
chr4 (53-97)||(25358454-25358498)
chr4 (45-97)||(50822013-50822065)
chr4 (149-208)||(4211610-4211669)
chr4 (54-97)||(5063021-5063064)
chr4 (296-327)||(5063309-5063340)
chr4 (43-94)||(13764755-13764806)
chr4 (43-94)||(14594207-14594258)
chr4 (43-90)||(20144683-20144730)
chr4 (55-98)||(24774311-24774354)
chr4 (55-98)||(31811996-31812039)
chr4 (43-94)||(35119559-35119610)
chr4 (149-208)||(36050395-36050454)
chr4 (45-92)||(41920771-41920818)
chr4 (43-94)||(42824039-42824090)
chr4 (55-98)||(47135851-47135894)
chr4 (55-98)||(51763086-51763129)
chr4 (43-90)||(52543423-52543470)
chr4 (159-201)||(2034693-2034735)
chr4 (55-97)||(5797705-5797747)
chr4 (55-97)||(11692834-11692876)
chr4 (149-203)||(12791811-12791865)
chr4 (55-97)||(13530452-13530494)
chr4 (55-97)||(20144492-20144534)
chr4 (55-97)||(25424197-25424239)
chr4 (43-97)||(26313989-26314043)
chr4 (158-208)||(35119381-35119431)
chr4 (161-203)||(41439909-41439951)
chr4 (60-98)||(47022989-47023027)
chr4 (47-97)||(47532617-47532667)
chr4 (43-97)||(51762871-51762925)
chr4 (60-98)||(54208709-54208747)
chr4 (41-90)||(7639895-7639944)
chr4 (143-213)||(8191216-8191288)
chr4 (43-96)||(8905180-8905233)
chr4 (149-202)||(14488025-14488078)
chr4 (55-96)||(14594453-14594494)
chr4 (45-94)||(18135793-18135841)
chr4 (198-227)||(41316068-41316097)
chr4 (159-208)||(46115611-46115660)
chr4 (159-208)||(46128745-46128794)
chr4 (159-208)||(47022937-47022986)
chr4 (45-94)||(49123000-49123048)
chr4 (55-96)||(54903362-54903403)
[»] chr3 (281 HSPs)
chr3 (43-227)||(37506868-37507053)
chr3 (43-227)||(39288713-39288897)
chr3 (43-227)||(39436922-39437108)
chr3 (43-227)||(10976979-10977164)
chr3 (43-227)||(28427422-28427607)
chr3 (43-227)||(22155930-22156116)
chr3 (43-227)||(3151925-3152110)
chr3 (43-225)||(8510215-8510399)
chr3 (45-227)||(20757403-20757585)
chr3 (43-227)||(51834756-51834941)
chr3 (43-227)||(275445-275628)
chr3 (43-227)||(45320794-45320978)
chr3 (142-227)||(13584105-13584190)
chr3 (45-227)||(20907271-20907454)
chr3 (43-223)||(21159634-21159816)
chr3 (43-227)||(26799889-26800075)
chr3 (43-227)||(40169467-40169653)
chr3 (44-227)||(29955300-29955485)
chr3 (44-227)||(30004454-30004639)
chr3 (43-227)||(14633701-14633888)
chr3 (43-216)||(20612724-20612897)
chr3 (43-227)||(34238599-34238784)
chr3 (43-227)||(39072027-39072212)
chr3 (142-227)||(4950181-4950266)
chr3 (67-227)||(10778546-10778706)
chr3 (142-223)||(19656721-19656802)
chr3 (43-227)||(30130159-30130343)
chr3 (45-223)||(45161116-45161294)
chr3 (43-227)||(31869771-31869955)
chr3 (43-224)||(4513438-4513619)
chr3 (143-227)||(18175889-18175973)
chr3 (43-227)||(25710686-25710869)
chr3 (43-227)||(3830135-3830317)
chr3 (142-227)||(7518261-7518346)
chr3 (142-227)||(12673819-12673904)
chr3 (142-227)||(16123242-16123327)
chr3 (158-227)||(49670652-49670721)
chr3 (43-227)||(51500500-51500684)
chr3 (43-208)||(5345522-5345688)
chr3 (142-227)||(46186584-46186669)
chr3 (142-227)||(50261755-50261839)
chr3 (143-227)||(15016561-15016645)
chr3 (43-223)||(9863221-9863403)
chr3 (43-210)||(29445955-29446124)
chr3 (142-227)||(45521650-45521735)
chr3 (158-227)||(53701476-53701545)
chr3 (143-227)||(15286318-15286402)
chr3 (31-99)||(22156236-22156304)
chr3 (143-227)||(51759922-51760006)
chr3 (142-204)||(47901901-47901963)
chr3 (43-223)||(4814719-4814897)
chr3 (151-227)||(30426099-30426175)
chr3 (143-227)||(30552246-30552330)
chr3 (43-99)||(51834609-51834665)
chr3 (144-227)||(50196401-50196484)
chr3 (43-97)||(4513264-4513318)
chr3 (43-97)||(4950038-4950092)
chr3 (43-97)||(37507167-37507221)
chr3 (689-778)||(50518753-50518842)
chr3 (43-96)||(3151751-3151804)
chr3 (44-97)||(50196301-50196354)
chr3 (43-99)||(13584310-13584366)
chr3 (43-99)||(28942848-28942904)
chr3 (43-99)||(39436719-39436775)
chr3 (163-227)||(43440614-43440678)
chr3 (43-94)||(3830464-3830515)
chr3 (44-99)||(14633547-14633602)
chr3 (160-219)||(40979479-40979538)
chr3 (30-97)||(51550070-51550137)
chr3 (41-99)||(3361761-3361819)
chr3 (43-97)||(15016389-15016443)
chr3 (43-97)||(16123140-16123194)
chr3 (43-97)||(22008527-22008581)
chr3 (43-97)||(22008835-22008889)
chr3 (43-97)||(22016045-22016099)
chr3 (43-97)||(25615976-25616030)
chr3 (43-97)||(28552328-28552382)
chr3 (43-97)||(30268506-30268560)
chr3 (43-97)||(31480137-31480191)
chr3 (43-97)||(49323783-49323837)
chr3 (43-97)||(53701608-53701662)
chr3 (43-97)||(54608519-54608573)
chr3 (45-97)||(8940470-8940522)
chr3 (43-95)||(9262102-9262154)
chr3 (43-99)||(10977284-10977340)
chr3 (41-97)||(11463231-11463287)
chr3 (43-99)||(20611021-20611077)
chr3 (43-99)||(28427246-28427302)
chr3 (143-219)||(30268585-30268661)
chr3 (43-99)||(39288574-39288630)
chr3 (43-95)||(40370536-40370588)
chr3 (689-775)||(4171075-4171161)
chr3 (149-208)||(7957059-7957118)
chr3 (43-94)||(46751272-46751323)
chr3 (43-97)||(474045-474099)
chr3 (43-97)||(1721397-1721451)
chr3 (43-97)||(4034718-4034772)
chr3 (43-97)||(9261790-9261844)
chr3 (43-97)||(12673645-12673699)
chr3 (43-97)||(12740908-12740962)
chr3 (43-97)||(12741216-12741270)
chr3 (43-97)||(15979339-15979393)
chr3 (43-97)||(19844526-19844580)
chr3 (43-97)||(26089731-26089785)
chr3 (43-97)||(26090023-26090077)
chr3 (43-97)||(28552022-28552076)
chr3 (47-97)||(29955611-29955661)
chr3 (47-97)||(30004766-30004816)
chr3 (43-97)||(30106165-30106219)
chr3 (43-97)||(31480445-31480499)
chr3 (43-97)||(32119529-32119583)
chr3 (43-97)||(43441548-43441602)
chr3 (43-97)||(44802283-44802337)
chr3 (43-97)||(45002022-45002076)
chr3 (43-97)||(45002330-45002384)
chr3 (43-97)||(46186716-46186770)
chr3 (43-97)||(47336229-47336283)
chr3 (43-97)||(47336526-47336580)
chr3 (43-97)||(48924185-48924239)
chr3 (43-97)||(50196602-50196656)
chr3 (43-97)||(51550391-51550445)
chr3 (43-97)||(54608808-54608862)
chr3 (43-96)||(9603630-9603683)
chr3 (41-94)||(25610078-25610131)
chr3 (43-190)||(28942526-28942674)
chr3 (44-97)||(45006194-45006247)
chr3 (43-99)||(49670745-49670802)
chr3 (42-91)||(51760069-51760118)
chr3 (43-95)||(14772212-14772264)
chr3 (43-99)||(34238858-34238914)
chr3 (45-97)||(35569081-35569133)
chr3 (43-99)||(40169345-40169401)
chr3 (43-94)||(3387552-3387603)
chr3 (43-90)||(4814541-4814588)
chr3 (43-94)||(7518091-7518142)
chr3 (48-99)||(8510472-8510523)
chr3 (45-96)||(9863050-9863100)
chr3 (43-94)||(19656542-19656593)
chr3 (43-94)||(21159454-21159505)
chr3 (43-94)||(29446154-29446205)
chr3 (38-93)||(29490692-29490747)
chr3 (43-94)||(29525106-29525157)
chr3 (149-208)||(40277931-40277990)
chr3 (55-94)||(43440735-43440774)
chr3 (43-94)||(46186410-46186461)
chr3 (43-94)||(47005467-47005518)
chr3 (43-94)||(52342531-52342582)
chr3 (43-97)||(474353-474407)
chr3 (43-97)||(4034998-4035052)
chr3 (43-97)||(7957171-7957225)
chr3 (43-97)||(9596759-9596813)
chr3 (43-97)||(9597040-9597094)
chr3 (43-93)||(15286157-15286207)
chr3 (43-97)||(15979646-15979700)
chr3 (43-97)||(21553890-21553944)
chr3 (47-97)||(25710515-25710565)
chr3 (43-97)||(28452321-28452375)
chr3 (43-97)||(30552423-30552477)
chr3 (43-97)||(35565509-35565563)
chr3 (43-97)||(40545565-40545619)
chr3 (43-97)||(40979655-40979709)
chr3 (43-97)||(43441271-43441325)
chr3 (43-97)||(45313808-45313862)
chr3 (43-97)||(47005155-47005209)
chr3 (43-97)||(51759820-51759874)
chr3 (681-776)||(25648013-25648109)
chr3 (159-208)||(30034304-30034353)
chr3 (44-97)||(31869596-31869649)
chr3 (43-96)||(43440496-43440549)
chr3 (144-213)||(45313690-45313759)
chr3 (45-97)||(3387268-3387320)
chr3 (44-92)||(7518396-7518444)
chr3 (43-95)||(30426174-30426225)
chr3 (45-97)||(49324091-49324143)
chr3 (149-208)||(4034826-4034885)
chr3 (149-208)||(9261986-9262045)
chr3 (43-90)||(9603871-9603918)
chr3 (47-94)||(30130452-30130499)
chr3 (43-90)||(52342196-52342243)
chr3 (158-208)||(2486734-2486784)
chr3 (44-90)||(2486854-2486900)
chr3 (43-93)||(7588319-7588369)
chr3 (43-97)||(19844266-19844320)
chr3 (43-97)||(27681627-27681681)
chr3 (43-97)||(29678025-29678079)
chr3 (43-97)||(30034417-30034471)
chr3 (43-97)||(30128285-30128339)
chr3 (43-93)||(30424629-30424679)
chr3 (43-97)||(32119221-32119275)
chr3 (692-766)||(33143619-33143693)
chr3 (149-191)||(36673072-36673114)
chr3 (43-97)||(40277823-40277877)
chr3 (43-97)||(46622074-46622128)
chr3 (163-217)||(46901222-46901276)
chr3 (43-93)||(47114488-47114538)
chr3 (45-95)||(47901803-47901853)
chr3 (43-97)||(47902090-47902144)
chr3 (43-93)||(51500399-51500449)
chr3 (43-92)||(275783-275832)
chr3 (45-94)||(8555256-8555305)
chr3 (159-208)||(9596927-9596976)
chr3 (44-97)||(14772470-14772523)
chr3 (44-93)||(16679678-16679727)
chr3 (159-208)||(20405055-20405104)
chr3 (43-84)||(25353200-25353241)
chr3 (43-92)||(35177256-35177305)
chr3 (159-208)||(35177374-35177423)
chr3 (159-208)||(35565627-35565676)
chr3 (43-92)||(46901105-46901154)
chr3 (45-97)||(863597-863649)
chr3 (732-784)||(1652583-1652635)
chr3 (45-97)||(1721092-1721144)
chr3 (44-92)||(2486581-2486629)
chr3 (45-97)||(4322134-4322186)
chr3 (45-97)||(8940163-8940215)
chr3 (45-97)||(10778373-10778425)
chr3 (53-97)||(25610016-25610060)
chr3 (41-97)||(28418845-28418901)
chr3 (158-202)||(35533395-35533439)
chr3 (45-97)||(40545784-40545836)
chr3 (45-93)||(40723121-40723169)
chr3 (45-97)||(45005889-45005941)
chr3 (45-128)||(49670477-49670560)
chr3 (149-201)||(52342421-52342473)
chr3 (63-94)||(590197-590228)
chr3 (55-98)||(3387338-3387381)
chr3 (149-208)||(8555140-8555199)
chr3 (45-92)||(12673931-12673978)
chr3 (43-94)||(13514525-13514576)
chr3 (53-92)||(16123452-16123490)
chr3 (43-97)||(18175792-18175844)
chr3 (158-201)||(28418659-28418702)
chr3 (43-94)||(28452148-28452199)
chr3 (55-98)||(35565581-35565624)
chr3 (152-203)||(36732750-36732801)
chr3 (43-94)||(38232242-38232293)
chr3 (55-98)||(39132791-39132834)
chr3 (55-98)||(45005959-45006002)
chr3 (55-98)||(52956584-52956627)
chr3 (153-208)||(53113496-53113551)
chr3 (55-97)||(4034790-4034832)
chr3 (55-97)||(7957112-7957154)
chr3 (55-97)||(9262039-9262081)
chr3 (43-93)||(11463430-11463480)
chr3 (296-326)||(15016382-15016412)
chr3 (43-97)||(20405168-20405222)
chr3 (43-97)||(20644506-20644560)
chr3 (43-97)||(20644821-20644875)
chr3 (43-93)||(20757724-20757774)
chr3 (43-97)||(25609768-25609822)
chr3 (43-97)||(29686545-29686599)
chr3 (44-90)||(30034109-30034155)
chr3 (43-97)||(35407735-35407789)
chr3 (43-97)||(35498417-35498471)
chr3 (43-97)||(40370286-40370340)
chr3 (149-191)||(50009029-50009071)
chr3 (43-97)||(50009229-50009283)
chr3 (43-93)||(50261885-50261935)
chr3 (55-97)||(52342467-52342509)
chr3 (43-89)||(53113444-53113490)
chr3 (43-97)||(53701362-53701416)
chr3 (159-204)||(8940361-8940406)
chr3 (149-202)||(9603738-9603791)
chr3 (159-208)||(11463313-11463362)
chr3 (159-204)||(12741026-12741071)
chr3 (158-211)||(14772330-14772383)
chr3 (147-208)||(16679796-16679857)
chr3 (61-98)||(20644584-20644621)
chr3 (45-94)||(20807800-20807849)
chr3 (159-204)||(22008726-22008771)
chr3 (159-204)||(22016244-22016289)
chr3 (43-80)||(26273786-26273823)
chr3 (55-96)||(28452262-28452303)
chr3 (43-96)||(29678333-29678386)
chr3 (60-97)||(33794751-33794788)
chr3 (43-92)||(36673195-36673244)
chr3 (163-208)||(40370420-40370465)
chr3 (55-96)||(40370474-40370515)
chr3 (60-97)||(40560492-40560529)
chr3 (159-204)||(45002140-45002185)
chr3 (159-208)||(45006005-45006054)
[»] chr7 (232 HSPs)
chr7 (43-227)||(44508721-44508905)
chr7 (43-227)||(45073456-45073640)
chr7 (43-227)||(7431952-7432138)
chr7 (43-227)||(35015033-35015219)
chr7 (43-227)||(17999538-17999720)
chr7 (43-227)||(37372719-37372903)
chr7 (43-227)||(1007043-1007228)
chr7 (43-227)||(44344605-44344788)
chr7 (43-227)||(45021495-45021682)
chr7 (142-227)||(6108511-6108596)
chr7 (142-227)||(39719455-39719540)
chr7 (43-227)||(28911578-28911764)
chr7 (43-227)||(19783816-19784001)
chr7 (45-223)||(30352563-30352743)
chr7 (43-227)||(1559520-1559704)
chr7 (142-227)||(12894216-12894301)
chr7 (142-227)||(31732265-31732350)
chr7 (43-227)||(48358891-48359074)
chr7 (32-227)||(18022357-18022552)
chr7 (43-226)||(19561155-19561333)
chr7 (142-226)||(21223508-21223592)
chr7 (54-227)||(5308501-5308675)
chr7 (43-227)||(21554567-21554752)
chr7 (43-227)||(39832907-39833090)
chr7 (142-227)||(488814-488899)
chr7 (143-227)||(18311682-18311766)
chr7 (43-226)||(44403067-44403248)
chr7 (142-222)||(46304201-46304281)
chr7 (43-227)||(19757749-19757936)
chr7 (45-211)||(30709328-30709494)
chr7 (142-227)||(35210326-35210411)
chr7 (143-227)||(10358105-10358189)
chr7 (143-227)||(31310493-31310577)
chr7 (142-219)||(14738700-14738777)
chr7 (43-223)||(20388275-20388456)
chr7 (43-227)||(13769775-13769957)
chr7 (43-207)||(25547325-25547489)
chr7 (158-227)||(19465735-19465804)
chr7 (43-99)||(1006836-1006892)
chr7 (43-99)||(6108335-6108391)
chr7 (143-227)||(23816849-23816933)
chr7 (43-99)||(44508997-44509053)
chr7 (160-227)||(1974140-1974207)
chr7 (142-205)||(22871162-22871225)
chr7 (43-97)||(12894347-12894401)
chr7 (43-97)||(28911851-28911905)
chr7 (41-97)||(6079808-6079864)
chr7 (143-227)||(46648516-46648599)
chr7 (43-97)||(1614849-1614903)
chr7 (43-97)||(3975550-3975604)
chr7 (43-97)||(6509209-6509263)
chr7 (43-97)||(6509415-6509469)
chr7 (43-97)||(8144603-8144657)
chr7 (43-97)||(8555744-8555798)
chr7 (43-97)||(9659634-9659688)
chr7 (43-97)||(10358313-10358367)
chr7 (43-97)||(16853534-16853588)
chr7 (43-97)||(17999466-17999520)
chr7 (43-97)||(19561395-19561449)
chr7 (43-97)||(23399613-23399667)
chr7 (43-97)||(23676397-23676451)
chr7 (43-97)||(25988694-25988748)
chr7 (43-97)||(26878016-26878070)
chr7 (43-97)||(29198607-29198661)
chr7 (43-97)||(35210460-35210514)
chr7 (43-97)||(39833181-39833235)
chr7 (43-97)||(45228863-45228917)
chr7 (43-97)||(48192433-48192487)
chr7 (43-96)||(21223694-21223747)
chr7 (44-97)||(32189335-32189388)
chr7 (43-99)||(14738947-14739003)
chr7 (43-99)||(30352847-30352903)
chr7 (163-227)||(43300730-43300794)
chr7 (45-97)||(48192260-48192312)
chr7 (43-94)||(3975786-3975837)
chr7 (43-94)||(18022652-18022703)
chr7 (46-97)||(37372441-37372492)
chr7 (43-97)||(1614560-1614614)
chr7 (43-97)||(1974010-1974064)
chr7 (43-97)||(5233809-5233863)
chr7 (43-97)||(5354769-5354823)
chr7 (43-97)||(8144296-8144350)
chr7 (43-97)||(10358002-10358056)
chr7 (43-97)||(13770026-13770080)
chr7 (43-97)||(23399921-23399975)
chr7 (43-93)||(23816671-23816721)
chr7 (43-97)||(25092161-25092215)
chr7 (43-97)||(25092493-25092547)
chr7 (43-97)||(25988386-25988440)
chr7 (43-97)||(27037594-27037648)
chr7 (43-97)||(27458400-27458454)
chr7 (43-97)||(31732102-31732156)
chr7 (47-97)||(35104240-35104290)
chr7 (43-97)||(35665878-35665932)
chr7 (43-97)||(35838282-35838336)
chr7 (43-97)||(39719587-39719641)
chr7 (43-97)||(41054181-41054235)
chr7 (43-97)||(44402961-44403015)
chr7 (43-97)||(45073315-45073369)
chr7 (44-97)||(17854151-17854204)
chr7 (158-227)||(32189209-32189278)
chr7 (43-92)||(45021806-45021855)
chr7 (53-97)||(1271544-1271588)
chr7 (689-753)||(6726083-6726147)
chr7 (45-97)||(16940997-16941049)
chr7 (45-97)||(23676135-23676187)
chr7 (163-227)||(41365031-41365094)
chr7 (143-223)||(45671314-45671394)
chr7 (43-94)||(6589022-6589073)
chr7 (45-96)||(11766920-11766971)
chr7 (43-94)||(21554394-21554445)
chr7 (45-92)||(25547256-25547303)
chr7 (43-94)||(30223743-30223794)
chr7 (43-94)||(35837925-35837976)
chr7 (43-94)||(43300613-43300664)
chr7 (43-94)||(46304087-46304138)
chr7 (43-90)||(46648667-46648714)
chr7 (43-94)||(46759659-46759710)
chr7 (43-94)||(48852445-48852496)
chr7 (43-97)||(1559344-1559398)
chr7 (43-97)||(2945790-2945844)
chr7 (43-97)||(5234149-5234203)
chr7 (43-97)||(5308324-5308378)
chr7 (43-97)||(11767220-11767274)
chr7 (43-97)||(12932728-12932782)
chr7 (43-97)||(16940763-16940817)
chr7 (43-93)||(21223406-21223456)
chr7 (43-97)||(28262714-28262768)
chr7 (43-97)||(29198304-29198358)
chr7 (43-97)||(30223462-30223516)
chr7 (43-93)||(30709593-30709643)
chr7 (43-93)||(39438742-39438792)
chr7 (43-97)||(39438974-39439028)
chr7 (43-93)||(39719354-39719404)
chr7 (43-97)||(41053843-41053897)
chr7 (43-97)||(44568327-44568381)
chr7 (43-97)||(44568635-44568689)
chr7 (43-97)||(46304329-46304383)
chr7 (43-97)||(46759887-46759941)
chr7 (43-97)||(46828945-46828999)
chr7 (45-94)||(6589222-6589271)
chr7 (44-93)||(6847068-6847117)
chr7 (41-90)||(18311579-18311628)
chr7 (43-88)||(31310633-31310678)
chr7 (149-202)||(35665984-35666037)
chr7 (43-92)||(41365164-41365213)
chr7 (53-93)||(5355066-5355106)
chr7 (57-97)||(12894056-12894096)
chr7 (57-97)||(19758004-19758044)
chr7 (45-93)||(31503732-31503780)
chr7 (43-91)||(31732402-31732450)
chr7 (45-97)||(38186369-38186421)
chr7 (45-97)||(44841359-44841411)
chr7 (689-768)||(8745467-8745546)
chr7 (149-208)||(9659464-9659523)
chr7 (43-94)||(14543711-14543762)
chr7 (55-94)||(14738613-14738652)
chr7 (43-90)||(32189077-32189124)
chr7 (45-96)||(34877777-34877828)
chr7 (43-97)||(489017-489071)
chr7 (45-99)||(7432195-7432249)
chr7 (43-97)||(9659356-9659410)
chr7 (43-97)||(19465926-19465979)
chr7 (43-97)||(20388620-20388674)
chr7 (143-213)||(24953979-24954049)
chr7 (43-97)||(26877679-26877733)
chr7 (43-93)||(31310366-31310416)
chr7 (689-727)||(33719344-33719382)
chr7 (55-97)||(35104091-35104133)
chr7 (43-97)||(35470225-35470279)
chr7 (43-97)||(37527367-37527421)
chr7 (43-97)||(39520399-39520453)
chr7 (55-97)||(41054121-41054163)
chr7 (43-97)||(41364885-41364939)
chr7 (43-97)||(44958451-44958505)
chr7 (43-97)||(45228616-45228670)
chr7 (43-97)||(46829257-46829311)
chr7 (159-208)||(5354950-5354999)
chr7 (36-97)||(6892205-6892266)
chr7 (159-208)||(11767036-11767085)
chr7 (43-96)||(24717478-24717531)
chr7 (53-94)||(24953831-24953872)
chr7 (159-208)||(30223580-30223629)
chr7 (147-208)||(35104125-35104186)
chr7 (44-97)||(37952671-37952724)
chr7 (160-213)||(38186589-38186642)
chr7 (159-208)||(39520517-39520566)
chr7 (689-781)||(42532923-42533015)
chr7 (44-97)||(43058752-43058805)
chr7 (45-93)||(18891514-18891562)
chr7 (143-191)||(37952902-37952950)
chr7 (45-93)||(37953000-37953048)
chr7 (45-97)||(39520675-39520727)
chr7 (45-97)||(45671217-45671269)
chr7 (32-96)||(45671494-45671558)
chr7 (43-90)||(6911199-6911246)
chr7 (46-93)||(6954862-6954909)
chr7 (159-202)||(16940881-16940924)
chr7 (55-98)||(27458472-27458515)
chr7 (43-90)||(34878077-34878124)
chr7 (161-208)||(35470112-35470159)
chr7 (55-98)||(35470164-35470207)
chr7 (149-208)||(35838033-35838092)
chr7 (55-98)||(41054060-41054103)
chr7 (149-208)||(46759805-46759864)
chr7 (149-191)||(2945694-2945736)
chr7 (43-97)||(3807865-3807919)
chr7 (55-93)||(3808068-3808106)
chr7 (55-97)||(3975724-3975766)
chr7 (296-326)||(7431945-7431975)
chr7 (55-97)||(9659428-9659470)
chr7 (144-186)||(17854314-17854356)
chr7 (43-93)||(18927040-18927090)
chr7 (43-97)||(22539931-22539985)
chr7 (43-97)||(23816979-23817033)
chr7 (63-97)||(27458664-27458698)
chr7 (43-97)||(28528906-28528960)
chr7 (43-97)||(35210183-35210237)
chr7 (43-93)||(35469881-35469931)
chr7 (55-93)||(38186709-38186747)
chr7 (160-202)||(38486631-38486673)
chr7 (43-93)||(38486739-38486789)
chr7 (158-208)||(44841473-44841523)
chr7 (43-97)||(48854015-48854069)
chr7 (149-202)||(3975677-3975730)
chr7 (159-208)||(6589080-6589129)
chr7 (44-97)||(18926889-18926942)
chr7 (159-208)||(27458518-27458567)
chr7 (296-325)||(31732096-31732125)
chr7 (152-209)||(34877885-34877942)
chr7 (159-208)||(41054008-41054057)
chr7 (163-208)||(45228707-45228752)
[»] scaffold0373 (1 HSPs)
scaffold0373 (43-227)||(8548-8734)
[»] chr8 (214 HSPs)
chr8 (41-227)||(6146762-6146950)
chr8 (30-227)||(1525797-1525996)
chr8 (43-218)||(4375693-4375867)
chr8 (43-227)||(33636323-33636509)
chr8 (43-227)||(19494120-19494305)
chr8 (43-227)||(38930303-38930488)
chr8 (41-223)||(4016904-4017085)
chr8 (43-226)||(16643858-16644043)
chr8 (43-227)||(16789187-16789368)
chr8 (41-227)||(6146515-6146701)
chr8 (43-227)||(28398853-28399034)
chr8 (43-227)||(24187570-24187753)
chr8 (43-227)||(24954825-24955009)
chr8 (43-227)||(8094480-8094666)
chr8 (43-226)||(25131112-25131294)
chr8 (43-227)||(1162910-1163098)
chr8 (43-223)||(1408172-1408352)
chr8 (142-227)||(14495214-14495299)
chr8 (142-227)||(21509796-21509881)
chr8 (142-227)||(22917741-22917826)
chr8 (143-227)||(21125835-21125919)
chr8 (43-226)||(10776313-10776498)
chr8 (43-227)||(27341404-27341590)
chr8 (142-225)||(22650568-22650651)
chr8 (142-227)||(7272522-7272607)
chr8 (43-227)||(14488717-14488901)
chr8 (43-227)||(29487925-29488109)
chr8 (142-227)||(32040187-32040272)
chr8 (143-227)||(15719758-15719842)
chr8 (43-205)||(40492961-40493117)
chr8 (43-222)||(40066498-40066675)
chr8 (43-223)||(14238752-14238932)
chr8 (142-227)||(18549305-18549390)
chr8 (142-227)||(30337023-30337108)
chr8 (143-227)||(10755345-10755429)
chr8 (143-223)||(19963099-19963179)
chr8 (43-227)||(29158355-29158541)
chr8 (143-227)||(32418493-32418577)
chr8 (143-223)||(33526155-33526235)
chr8 (143-227)||(43727244-43727328)
chr8 (45-200)||(1685117-1685274)
chr8 (31-227)||(7578345-7578539)
chr8 (43-99)||(19494356-19494412)
chr8 (43-99)||(22917565-22917621)
chr8 (32-223)||(35143664-35143854)
chr8 (143-223)||(40844354-40844434)
chr8 (143-223)||(43477331-43477411)
chr8 (43-97)||(14239025-14239079)
chr8 (43-97)||(43477164-43477218)
chr8 (43-99)||(1526115-1526171)
chr8 (43-99)||(16643662-16643718)
chr8 (43-94)||(32418319-32418370)
chr8 (43-97)||(2728542-2728596)
chr8 (43-97)||(4017245-4017299)
chr8 (43-97)||(4710165-4710219)
chr8 (43-97)||(7272696-7272750)
chr8 (43-97)||(7326366-7326420)
chr8 (43-97)||(11019802-11019856)
chr8 (43-97)||(11976374-11976428)
chr8 (43-97)||(14495070-14495124)
chr8 (43-97)||(28346395-28346449)
chr8 (43-97)||(28346703-28346757)
chr8 (43-97)||(32726216-32726270)
chr8 (43-97)||(33526357-33526411)
chr8 (43-97)||(34963301-34963355)
chr8 (43-97)||(35097637-35097691)
chr8 (43-97)||(37536087-37536141)
chr8 (43-97)||(40066765-40066819)
chr8 (43-97)||(40844157-40844211)
chr8 (43-96)||(25131393-25131446)
chr8 (43-95)||(8094788-8094840)
chr8 (43-99)||(38930607-38930663)
chr8 (43-97)||(1778565-1778619)
chr8 (43-97)||(3511907-3511961)
chr8 (43-97)||(3512211-3512265)
chr8 (43-97)||(4473989-4474043)
chr8 (43-97)||(4621299-4621353)
chr8 (43-97)||(7185949-7186003)
chr8 (43-93)||(7272421-7272471)
chr8 (43-97)||(7326087-7326141)
chr8 (43-97)||(7420231-7420285)
chr8 (43-97)||(7420535-7420589)
chr8 (43-97)||(8298588-8298642)
chr8 (43-97)||(8298920-8298974)
chr8 (43-97)||(9496668-9496722)
chr8 (43-97)||(10337120-10337174)
chr8 (43-97)||(10337394-10337448)
chr8 (43-97)||(10540727-10540781)
chr8 (43-97)||(10872916-10872970)
chr8 (43-97)||(10873225-10873279)
chr8 (43-97)||(11019521-11019575)
chr8 (43-97)||(14489018-14489072)
chr8 (43-219)||(14496817-14496991)
chr8 (43-97)||(16789076-16789130)
chr8 (43-93)||(18549202-18549252)
chr8 (43-97)||(20277693-20277747)
chr8 (43-97)||(20984147-20984201)
chr8 (43-97)||(21064320-21064374)
chr8 (43-97)||(21125720-21125774)
chr8 (43-97)||(22650465-22650519)
chr8 (43-93)||(24090437-24090487)
chr8 (43-97)||(24187842-24187896)
chr8 (43-97)||(32725908-32725962)
chr8 (43-97)||(34963609-34963663)
chr8 (43-97)||(35097329-35097383)
chr8 (43-97)||(35345562-35345616)
chr8 (43-97)||(35346630-35346684)
chr8 (43-97)||(35346943-35346997)
chr8 (43-97)||(37536364-37536418)
chr8 (43-97)||(42133099-42133153)
chr8 (43-96)||(5357424-5357477)
chr8 (43-96)||(10755474-10755527)
chr8 (43-95)||(14495337-14495389)
chr8 (44-97)||(18549518-18549571)
chr8 (43-96)||(28323850-28323903)
chr8 (37-97)||(9496336-9496396)
chr8 (45-97)||(11976681-11976733)
chr8 (45-97)||(13232201-13232253)
chr8 (43-95)||(15719657-15719709)
chr8 (45-97)||(28497564-28497616)
chr8 (45-97)||(40844480-40844532)
chr8 (43-94)||(20278005-20278056)
chr8 (43-94)||(21064632-21064683)
chr8 (149-208)||(28497363-28497422)
chr8 (43-94)||(33526053-33526104)
chr8 (149-208)||(35115531-35115590)
chr8 (43-97)||(2728233-2728287)
chr8 (43-97)||(4473705-4473759)
chr8 (43-97)||(6469281-6469335)
chr8 (44-90)||(10776150-10776196)
chr8 (43-97)||(13779477-13779531)
chr8 (43-97)||(17073808-17073862)
chr8 (43-97)||(17574408-17574462)
chr8 (43-97)||(20984455-20984509)
chr8 (43-97)||(25600231-25600285)
chr8 (43-97)||(35115584-35115638)
chr8 (43-97)||(42132865-42132919)
chr8 (43-96)||(10540450-10540503)
chr8 (43-92)||(13232512-13232561)
chr8 (43-96)||(27117922-27117975)
chr8 (43-99)||(1163217-1163273)
chr8 (45-93)||(9175320-9175368)
chr8 (43-87)||(40493112-40493156)
chr8 (55-98)||(7420303-7420346)
chr8 (149-208)||(8298696-8298755)
chr8 (55-98)||(13232271-13232314)
chr8 (55-98)||(20277765-20277808)
chr8 (55-98)||(21064392-21064435)
chr8 (47-94)||(24814710-24814757)
chr8 (43-94)||(28497256-28497307)
chr8 (43-94)||(29158617-29158668)
chr8 (45-92)||(33652193-33652240)
chr8 (55-98)||(42430004-42430047)
chr8 (43-94)||(42430068-42430119)
chr8 (193-227)||(1686477-1686511)
chr8 (47-97)||(3680532-3680582)
chr8 (43-97)||(3680746-3680800)
chr8 (43-93)||(4375960-4376009)
chr8 (43-93)||(5357712-5357762)
chr8 (43-97)||(9175013-9175067)
chr8 (43-97)||(13154887-13154941)
chr8 (43-97)||(13155196-13155250)
chr8 (43-97)||(19962996-19963050)
chr8 (43-97)||(21125966-21126020)
chr8 (43-97)||(24815013-24815067)
chr8 (43-97)||(25600542-25600596)
chr8 (43-97)||(25702513-25702567)
chr8 (43-97)||(27117754-27117808)
chr8 (43-97)||(28324126-28324180)
chr8 (47-97)||(29992245-29992295)
chr8 (43-97)||(32040076-32040130)
chr8 (44-94)||(43727382-43727431)
chr8 (159-208)||(7326205-7326254)
chr8 (159-208)||(7420349-7420398)
chr8 (44-97)||(13779151-13779204)
chr8 (149-202)||(20277801-20277854)
chr8 (149-202)||(21064428-21064481)
chr8 (43-88)||(30337171-30337216)
chr8 (41-90)||(36044744-36044793)
chr8 (44-97)||(43727097-43727150)
chr8 (43-91)||(1408006-1408054)
chr8 (45-93)||(2811730-2811778)
chr8 (45-93)||(29991918-29991966)
chr8 (54-97)||(1778874-1778917)
chr8 (158-209)||(2811559-2811610)
chr8 (55-98)||(4473777-4473820)
chr8 (149-208)||(6469498-6469557)
chr8 (55-98)||(10540522-10540565)
chr8 (61-96)||(14847844-14847879)
chr8 (147-202)||(23939654-23939709)
chr8 (43-94)||(28258189-28258240)
chr8 (43-78)||(28398757-28398792)
chr8 (43-94)||(29487751-29487802)
chr8 (149-208)||(29992133-29992192)
chr8 (149-208)||(42429952-42430011)
chr8 (43-90)||(44997932-44997979)
chr8 (159-201)||(1778683-1778725)
chr8 (55-97)||(8298660-8298702)
chr8 (158-208)||(9175204-9175254)
chr8 (163-209)||(10873112-10873158)
chr8 (43-97)||(15930933-15930987)
chr8 (158-208)||(15931101-15931151)
chr8 (55-97)||(17074053-17074095)
chr8 (55-97)||(17574175-17574217)
chr8 (55-97)||(23939620-23939662)
chr8 (47-97)||(26530673-26530723)
chr8 (43-97)||(30969399-30969453)
chr8 (43-97)||(42429759-42429812)
chr8 (159-201)||(44998104-44998146)
chr8 (55-97)||(44998149-44998191)
chr8 (159-208)||(4473823-4473872)
chr8 (159-204)||(11976572-11976617)
chr8 (159-208)||(13232317-13232366)
chr8 (43-92)||(23939548-23939597)
[»] scaffold0811 (2 HSPs)
scaffold0811 (43-227)||(1457-1643)
scaffold0811 (43-99)||(1312-1368)
[»] scaffold0021 (2 HSPs)
scaffold0021 (43-227)||(12183-12369)
scaffold0021 (43-94)||(12484-12535)
[»] scaffold0051 (2 HSPs)
scaffold0051 (43-227)||(5520-5707)
scaffold0051 (43-99)||(5400-5456)
[»] scaffold0210 (2 HSPs)
scaffold0210 (43-223)||(14698-14878)
scaffold0210 (43-97)||(14957-15011)
[»] scaffold0347 (3 HSPs)
scaffold0347 (43-227)||(4127-4311)
scaffold0347 (53-97)||(4020-4064)
scaffold0347 (296-327)||(4288-4319)
[»] scaffold0179 (1 HSPs)
scaffold0179 (43-227)||(3106-3290)
[»] scaffold0535 (2 HSPs)
scaffold0535 (43-227)||(8842-9027)
scaffold0535 (44-97)||(8734-8787)
[»] scaffold0123 (2 HSPs)
scaffold0123 (142-227)||(17857-17942)
scaffold0123 (43-97)||(17988-18042)
[»] scaffold0003 (2 HSPs)
scaffold0003 (43-227)||(366090-366272)
scaffold0003 (43-97)||(365980-366034)
[»] scaffold0016 (3 HSPs)
scaffold0016 (142-223)||(10257-10338)
scaffold0016 (43-94)||(10169-10220)
scaffold0016 (43-97)||(10460-10514)
[»] scaffold0712 (1 HSPs)
scaffold0712 (43-213)||(5210-5382)
[»] scaffold0709 (1 HSPs)
scaffold0709 (43-213)||(5230-5402)
[»] scaffold0159 (2 HSPs)
scaffold0159 (142-227)||(35087-35170)
scaffold0159 (43-99)||(34932-34988)
[»] scaffold1001 (1 HSPs)
scaffold1001 (43-227)||(2779-2962)
[»] scaffold0065 (2 HSPs)
scaffold0065 (43-227)||(3734-3917)
scaffold0065 (43-94)||(3533-3584)
[»] scaffold0060 (3 HSPs)
scaffold0060 (142-227)||(8432-8517)
scaffold0060 (43-94)||(8331-8382)
scaffold0060 (43-94)||(8590-8641)
[»] scaffold0002 (3 HSPs)
scaffold0002 (143-226)||(94160-94243)
scaffold0002 (43-97)||(94058-94112)
scaffold0002 (43-90)||(94282-94329)
[»] scaffold0166 (2 HSPs)
scaffold0166 (142-225)||(24475-24558)
scaffold0166 (43-97)||(24373-24427)
[»] scaffold0056 (3 HSPs)
scaffold0056 (43-97)||(54816-54870)
scaffold0056 (45-97)||(50023-50075)
scaffold0056 (45-97)||(55124-55176)
[»] scaffold0026 (3 HSPs)
scaffold0026 (43-97)||(82651-82705)
scaffold0026 (43-97)||(82342-82396)
scaffold0026 (159-208)||(82460-82509)
[»] scaffold0024 (2 HSPs)
scaffold0024 (43-97)||(75709-75763)
scaffold0024 (43-97)||(75360-75414)
[»] scaffold0326 (6 HSPs)
scaffold0326 (43-99)||(4042-4098)
scaffold0326 (43-99)||(19224-19280)
scaffold0326 (43-99)||(4231-4287)
scaffold0326 (43-99)||(19413-19469)
scaffold0326 (151-198)||(4128-4175)
scaffold0326 (151-198)||(19310-19357)
[»] scaffold0337 (1 HSPs)
scaffold0337 (43-94)||(12526-12577)
[»] scaffold0160 (2 HSPs)
scaffold0160 (43-97)||(27309-27363)
scaffold0160 (55-97)||(27072-27114)
[»] scaffold0105 (2 HSPs)
scaffold0105 (43-97)||(17911-17965)
scaffold0105 (143-213)||(17791-17863)
[»] scaffold0005 (4 HSPs)
scaffold0005 (43-97)||(47926-47980)
scaffold0005 (45-93)||(48180-48228)
scaffold0005 (43-94)||(223120-223171)
scaffold0005 (55-96)||(222884-222925)
[»] scaffold0001 (2 HSPs)
scaffold0001 (43-97)||(148227-148281)
scaffold0001 (160-203)||(148007-148050)
[»] scaffold0684 (2 HSPs)
scaffold0684 (43-96)||(2606-2659)
scaffold0684 (158-208)||(2413-2463)
[»] scaffold0078 (2 HSPs)
scaffold0078 (43-93)||(4028-4078)
scaffold0078 (33-97)||(3743-3807)
[»] scaffold0176 (3 HSPs)
scaffold0176 (43-94)||(22003-22054)
scaffold0176 (158-208)||(21808-21858)
scaffold0176 (55-96)||(21763-21804)
[»] scaffold0119 (2 HSPs)
scaffold0119 (43-97)||(16725-16779)
scaffold0119 (149-208)||(16832-16891)
[»] scaffold0050 (1 HSPs)
scaffold0050 (689-778)||(37034-37124)
[»] scaffold0339 (1 HSPs)
scaffold0339 (43-92)||(3405-3454)
[»] scaffold0007 (3 HSPs)
scaffold0007 (43-96)||(2502-2555)
scaffold0007 (43-96)||(2829-2882)
scaffold0007 (153-202)||(2615-2664)
[»] scaffold0085 (1 HSPs)
scaffold0085 (43-97)||(35029-35083)
[»] scaffold1613 (1 HSPs)
scaffold1613 (689-765)||(659-736)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 210)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 323 - 625
Target Start/End: Original strand, 7194609 - 7194912
Alignment:
323 taaactatatagtataatttaaatttggatattttactaataacaataagaaactgcaggttctctgcattcgaagacatatattaaacaaaattgtttg 422  Q
    |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||    
7194609 taaactatatagtatatttaaaatttggatattttactaataacaataagaaactgcagttgctctgcattcgaagacatatattaaacaaaattgtttg 7194708  T
423 aacttaattatcgaacgtcgtgtgtgcattgtttacgtttattatttcnnnnnnn-atacttttgaactgagttgttgttcttactatactcctatttaa 521  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||    
7194709 aacttaattatcgaacatcgtgtgtgcattgtttacgtttattatttcttttttttatacttttgaactgagttgttgttcttactatactcctatttaa 7194808  T
522 gttctttaacacatggtagaatacaataatttcaaaggatagaaatttggttctacaacttttttgacaattatggtattctatcccatgtgaaataaat 621  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||    
7194809 gttctttaacacatggtagaatacaataatttcaaaggatagaaatttggttctacaacttttttgacaattatggtattctaccccatgtaaaataaat 7194908  T
622 aaat 625  Q
    ||||    
7194909 aaat 7194912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 18633960 - 18633774
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||           ||||||||||||||||||||                
18633960 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 18633861  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18633860 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 18633774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 28550828 - 28551012
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |         ||||||||||||| ||||||             |    
28550828 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 28550927  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28550928 aaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttggtccctgc 28551012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35166157 - 35165973
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||| |||| |||||||||||||||||| ||| ||||||||||||||||||||||||         || |||||||||||||||||             |    
35166157 gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaaaaaaaattatttttggtccctgcaaaattttttgtttttg 35166058  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35166057 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 35165973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 36577723 - 36577906
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |         |||||||||| |||||||||             |    
36577723 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggcccctgcaaaattttttgtttttg 36577821  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36577822 aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 36577906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 6118498 - 6118308
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn------ttgtttttggtccctgcaaacnnnnnnn 136  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||               ||||||||||||||||||||            
6118498 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 6118399  T
137 nnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
         ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6118398 tttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 6118308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29172524 - 29172710
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||| ||||||                
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt 29172623  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
29172624 tgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttcgtccctgc 29172710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35167164 - 35166979
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           || ||||||||||| ||||||                 
35167164 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaatttgtttttggtccttgcaaaaatttttgttttt 35167065  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35167064 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 35166979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 2217853 - 2217671
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||| |||             |    
2217853 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgtaaa--attttgtttttg 2217756  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
2217755 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttggtccctgc 2217671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29875401 - 29875586
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||||                 
29875401 gctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaatttttttgttttt 29875500  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
29875501 gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttggtccctgc 29875586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29693089 - 29692906
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||||||||||| |||||||||||||||||| || |         ||||||||||||||| ||||             |    
29693089 gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttg-taaaaaaaaattgtttttggtccctacaaaattttttgtttttg 29692991  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29692990 aaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 29692906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 30800849 - 30800665
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||             |    
30800849 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattttttttttgtttttggtccctgcaaaattttttgtttttg 30800750  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |  ||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
30800749 aaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaattttgaagtttttggtccctgc 30800665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 42207243 - 42207427
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| || ||||||| ||||||||||||||||||||||           ||||||||||||||||||||             |    
42207243 gctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 42207342  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
42207343 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgatccctgc 42207427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 5614529 - 5614347
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||           ||  ||||||||||||||||||                
5614529 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt 5614430  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5614429 tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 5614347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 15635379 - 15635558
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnt-tgtttttggtccctgcaaacnnnnnnnnnnnnga 143  Q
    ||||||| ||||||||||| |||||||||| || |||||||||||||||||||||           |||||||||||||||||||             ||    
15635379 taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataatgtttttggtccctgcaaaattttttgtttttga 15635478  T
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15635479 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 15635558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29151517 - 29151703
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||           ||||||||||| |||| |||                
29151517 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttttgtttt 29151616  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29151617 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 29151703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 30888161 - 30888347
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||  |          ||||||||||||||||||||                
30888161 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttgtttt 30888260  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
30888261 tgaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtagtttttggtccctgc 30888347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 5950177 - 5950359
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||             |    
5950177 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaaatgtttttggtccctgcaaaattttttgtttttg 5950274  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
5950275 aaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtagtttttggtctctgc 5950359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16616463 - 16616548
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16616463 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 16616548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 27850275 - 27850190
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27850275 gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 27850190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 38962992 - 38962907
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
38962992 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 38962907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 294091 - 294006
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
294091 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 294006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 21050576 - 21050760
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||| ||||||||| |||||||| ||||||||||||           ||||||||||||||||||||             |    
21050576 gctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 21050675  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
21050676 aaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtctctgc 21050760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38786160 - 38786343
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||           ||||||||||||||||||||             |    
38786160 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 38786259  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| | || ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
38786260 aaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacc-attttgtagtttttggtccctgc 38786343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 16038738 - 16038553
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||||| |||             ||||||||||||||||||||                 
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 16038639  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
16038638 gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 16038553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 10408929 - 10409117
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn 137  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||              ||||||||| ||||||||||             
10408929 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaaaaattgtttttgatccctgcaaaattttttgt 10409028  T
138 nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
        ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||    
10409029 ttttgaaaatagtccctga-cccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtctctgc 10409117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7075860 - 7075775
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||   ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
7075860 gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc 7075775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 223
Target Start/End: Complemental strand, 23382208 - 23382127
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||    
23382208 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc 23382127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 25779060 - 25778975
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||    
25779060 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttatagtttttggtccctgc 25778975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 31037497 - 31037582
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
31037497 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 31037582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 38496521 - 38496606
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
38496521 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 38496606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 144 - 227
Target Start/End: Complemental strand, 21125170 - 21125087
Alignment:
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
21125170 aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc 21125087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 33336025 - 33335838
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||              |||||||||||| |||||||               
33336025 gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtcgctgcaaaattttttgttt 33335926  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      ||||||||||| ||| |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
33335925 ttgaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaatcaattttgtagtttttggtccctgc 33335838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 37090640 - 37090555
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||    
37090640 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttggtctctgc 37090555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 39379330 - 39379411
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||| || ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
39379330 gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtcc 39379411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 43 - 225
Target Start/End: Original strand, 4203457 - 4203637
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| |||            ||||||||||||  ||||||             |    
4203457 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgccta--taaaaaaaattgtttttggtctgtgcaaaatttcttgtttttg 4203554  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||||||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||||| ||||||||||||    
4203555 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaattttgtaatttttggtccct 4203637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 25561706 - 25561894
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||           ||||||||||||||||||||                
25561706 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 25561805  T
141 ngaaaata-gtccctgaacccac-ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||| ||| |||| ||||| ||||||||||||||||||| || ||||||||||||||||  ||||||||||||||||||||||||    
25561806 tgaaaataagtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaataaattttgtagtttttggtccctgc 25561894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 18046250 - 18046165
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||    
18046250 gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaattttatagttcttggtccctgc 18046165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 34125308 - 34125491
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||| ||           ||||||||||||||||||||                  
34125308 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttt 34125407  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| |||| |||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
34125408 aaaatagtctctga-cccatttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 34125491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 3850525 - 3850441
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
3850525 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 3850441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 10744053 - 10743873
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||           ||||||||||||||| ||||                  
10744053 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccctacaaatttttttgtttttt 10743954  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| |||| ||||||||||||||||||| ||| ||||| || |||||||| |||||||||||||||||||    
10743953 aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtagtttttggtcc 10743873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 27916564 - 27916648
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||| ||||||||||||| || || || ||||||||||||||||||||||||||||||||    
27916564 aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtagtttttggtccctgc 27916648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 43 - 219
Target Start/End: Complemental strand, 28863837 - 28863656
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn 137  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||                ||||||||||||||||||||             
28863837 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaattttttgt 28863738  T
138 nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
         |||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||    
28863737 tttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtagtttttg 28863656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 146 - 227
Target Start/End: Complemental strand, 3850719 - 3850638
Alignment:
146 atagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||| |||| |||| || |||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
3850719 atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 3850638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14318300 - 14318215
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| || | ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| |||||||    
14318300 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgatccctgc 14318215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 18633600 - 18633656
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
18633600 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 18633656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29172885 - 29172829
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
29172885 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 29172829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29875724 - 29875668
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
29875724 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 29875668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13990894 - 13990843
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
13990894 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 13990843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 24782175 - 24782092
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||| |||| ||  || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||    
24782175 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttttgtccct 24782092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2217495 - 2217549
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
2217495 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 2217549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7075573 - 7075627
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
7075573 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7075627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28863511 - 28863565
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
28863511 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28863565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29692745 - 29692799
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
29692745 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29692799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30800495 - 30800549
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
30800495 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 30800549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36578082 - 36578028
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
36578082 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 36578028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40029496 - 40029442
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
40029496 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 40029442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9179919 - 9179736
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||           ||||||||||||||||||||                  
9179919 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttgtttttt- 9179821  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| | || |||| | |||||||||||||| |||||||||||| ||||| ||||| ||||| |||||||||||||||||    
9179820 aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacctattttatagtttttggtccctgc 9179736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 13990708 - 13990792
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| || | ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||| ||||||||    
13990708 aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtagtttttagtccctgc 13990792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 15635706 - 15635650
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||    
15635706 gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 15635650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 142 - 218
Target Start/End: Original strand, 40029240 - 40029316
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 218  Q
    ||||||||||||| |  |||||||||||||||||   ||||||| ||||||||||||||||||||||||||||||||    
40029240 gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaattttgtagttttt 40029316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10743725 - 10743776
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
10743725 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 10743776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 16038378 - 16038429
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
16038378 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 16038429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18046347 - 18046296
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18046347 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 18046296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1105147 - 1105093
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
1105147 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1105093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1381610 - 1381556
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
1381610 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1381556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5917459 - 5917405
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
5917459 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5917405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6912498 - 6912552
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
6912498 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 6912552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11799457 - 11799403
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
11799457 gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg 11799403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19565830 - 19565776
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
19565830 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19565776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19685379 - 19685325
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
19685379 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19685325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24443743 - 24443689
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24443743 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24443689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26133184 - 26133238
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
26133184 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 26133238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26133412 - 26133358
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
26133412 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 26133358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35928065 - 35928119
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
35928065 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35928119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 38170515 - 38170569
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
38170515 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38170569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| | |||||||||||||||||||||||||||||||||||||||||||||    
39379242 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt 39379296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40167787 - 40167841
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| || |||||||||||||||||||||||||||||||||||||||||||||    
40167787 gctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 40167841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40764416 - 40764470
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
40764416 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 40764470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 2636994 - 2636941
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||    
2636994 aagctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 2636941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 10409325 - 10409269
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||    
10409325 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggt 10409269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
20985728 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20985780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 25561998 - 25561942
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| || |||||    
25561998 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggt 25561942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29151850 - 29151794
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||    
29151850 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt 29151794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 38496781 - 38496725
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||  |||||||||||||||||||||||    
38496781 gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt 38496725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 39379609 - 39379553
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||    
39379609 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt 39379553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 293829 - 293880
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||||||    
293829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc 293880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 20660949 - 20661000
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||||||||    
20660949 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 20661000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 23382296 - 23382245
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
23382296 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc 23382245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45139 - 45193
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
45139 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1104859 - 1104913
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
1104859 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 1104913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1381248 - 1381302
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
1381248 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1381302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||||||||||||||||||| ||||||||||||||||||||||    
3850594 aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 3850544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4203769 - 4203715
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
4203769 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 4203715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5917127 - 5917181
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
5917127 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 5917181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11799130 - 11799184
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| | |||||||||||||||||||    
11799130 gctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg 11799184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18046039 - 18046093
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
18046039 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 18046093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19565468 - 19565522
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
19565468 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19565522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19685018 - 19685072
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
19685018 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19685072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20986088 - 20986034
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
20986088 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 20986034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21050912 - 21050858
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||    
21050912 gctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg 21050858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21124914 - 21124968
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||    
21124914 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 21124968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24443381 - 24443435
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
24443381 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 24443435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24781990 - 24782044
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||    
24781990 gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg 24782044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 25992418 - 25992329
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccga-aataaacacccctaaaaacaccc 778  Q
    ||||||||||||| |||||||| ||| ||||| ||||||||  | ||| |||||||||||||||||| |||||||| ||||||||||||||    
25992418 agacgaacagagaccggtgaaaatgataatacaaacaaaaggcgccgtatatatgcggaacacccgacaataaaca-ccctaaaaacaccc 25992329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29366948 - 29366894
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
29366948 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 29366894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34125631 - 34125577
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||    
34125631 gctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg 34125577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35876689 - 35876743
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
35876689 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 35876743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35928457 - 35928403
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35928457 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35928403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37271360 - 37271414
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||    
37271360 gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 37271414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40764779 - 40764725
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
40764779 gctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg 40764725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 6912802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||||||    
9532532 taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc 9532483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||||    
27916761 taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc 27916713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||||| |||||||||||||||||||||||||||||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg 28108107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 29366847 - 29366763
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||| ||||||| |||| |||||||||||||| |||||||| ||||| || | |||||| ||||| ||||||||||| |||||    
29366847 aaaataatccctgaccccatttttgtgatgatttacatacgtgacacatgatgattgaacctattttatagtttttggttcctgc 29366763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 35166912 - 35166960
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag 91  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||    
35166912 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 2032939 - 2032888
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||| || |||||||||||||||||||||| |||||||||||||||||||    
2032939 gctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc 2032888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3850300 - 3850355
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttgg-ttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||    
3850300 gctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg 3850355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 5614167 - 5614218
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| ||||||||| |||||||||    
5614167 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 5614218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 97
Target Start/End: Original strand, 12144899 - 12144962
Alignment:
34 ataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| || ||||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||    
12144899 ataaaataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg 12144962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14318046 - 14318097
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||| |||||||||| |||||||||||||||||||    
14318046 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc 14318097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18258526 - 18258475
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||    
18258526 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 18258475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28213374 - 28213425
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||||||| |||||||||||||||    
28213374 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc 28213425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||    
31037740 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 31602265 - 31602320
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||||||||||| ||||||||||| |||| |||||| |||||||||    
31602265 cccacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag 31602320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1286683 - 1286737
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||| || |||||| |||||||||||||||||||||||||||||||    
1286683 gctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg 1286737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4736541 - 4736487
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||  |||||||||||||||||||||    
4736541 gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 4736487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9179594 - 9179648
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| ||||||||||  |||||||||||||||||||||    
9179594 gctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg 9179648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18258163 - 18258217
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
18258163 gctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg 18258217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20661310 - 20661256
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| ||||||||||| |||||||||||||||||||||    
20661310 gctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg 20661256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20683748 - 20683802
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| |||||||||||| |||||||| ||||||||||||    
20683748 gctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg 20683802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20690734 - 20690784
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
20690734 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 20690784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 22551214 - 22551144
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||| ||||||||||||||||  ||||||||||| |||| || |||||||  |||||||||    
22551214 aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag 22551144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23381951 - 23382005
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| || |||||||||||||| ||||    
23381951 gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg 23382005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25779161 - 25779107
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| || ||||||||||||| ||||    
25779161 gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg 25779107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 26405212 - 26405301
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    ||||||||| ||| |||||||||||||||||| ||||||||  ||||| ||||  ||||||||||| ||||||||| || |||||||||||    
26405212 agacgaacaaagaccggtgaaactgagaatacaaacaaaaggcgtcgtatatagtcggaacacccgaaaataaaca-ccttaaaaacaccc 26405301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28871993 - 28871939
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| || |||||| ||||||||||||||||||||||||||||||||| ||||    
28871993 gctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 28871939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35609304 - 35609358
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| ||||||||||| |||||||||||||||||||||    
35609304 gctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg 35609358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35877051 - 35876997
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||| |||||    
35877051 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg 35876997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37271705 - 37271651
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||| ||||||||||||    
37271705 gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 37271651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40029142 - 40029196
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||| ||||||| ||||||||||||||| ||||||    
40029142 gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg 40029196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40168007 - 40167953
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||||||| |||||||||| ||||||||||||||||||||||    
40168007 gctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg 40167953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 9532307 - 9532376
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| ||||||||||||||||||||||| ||||| |  || ||||| |||||||||||||| ||||||||    
9532307 cccatttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtagtttttagtccctgc 9532376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| |||||||||||||||||||||||||| |||| |||||||||    
16616370 ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc 16616419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 18286740 - 18286691
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||| | ||||||||||||||||||||| ||||||||||||||||||    
18286740 gctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt 18286691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 38962807 - 38962856
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||||||| ||||||| |||||||||||||||||    
38962807 gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt 38962856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||||||| | |||||||||||||||||||||||||||||||    
42207570 ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg 42207518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 96
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||| | |||||||| ||||||||||| |||||||||||||||||||||    
27850372 ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct 27850320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||| |||||| ||||||||||||||| |||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35609587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| |||||||| |||||||||||||    
42596814 taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg 42596762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 53 - 99
Target Start/End: Original strand, 6118143 - 6118190
Alignment:
53 ggttttagtccctgcaaatatgcctcgtttt-ggttttagtccctggt 99  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||    
6118143 ggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt 6118190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| |||||| |||||||||||||| ||||||||| |||||||||||||    
32888691 aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg 32888742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 42994069 - 42994116
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||||||||||||||||||| ||||||||| |||||    
42994069 gctaaaatatggttttagtccctgcaaatatgactcgttttgatttta 42994116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 2636670 - 2636720
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||| | ||||||||||||||||||    
2636670 gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 2636720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3851328 - 3851274
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||  ||||||| ||||||||| ||||||||||||    
3851328 gctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg 3851274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5904009 - 5904063
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||| |||||||||||||||||||| ||||||||||||    
5904009 gctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg 5904063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 17070646 - 17070708
Alignment:
151 ccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||| |||||||||||||||||||||| ||||||||||| || | |||| | |||||||||    
17070646 ccctgaccccacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtag 17070708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17070862 - 17070808
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| |||||||| |||||||| ||||||| |||||    
17070862 gctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg 17070808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||| ||||||||||||||||||||||||| ||||||||    
20690840 gtccctgaccccacttttgtgatgatttgcatacatggcacat 20690882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36973709 - 36973655
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||| ||||||||| ||||||||||||    
36973709 gctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg 36973655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40038857 - 40038803
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||||||||||||||||| |||||||||||| ||||||    
40038857 gctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg 40038803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42553643 - 42553693
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||| ||||||||||||||| ||||||||||||||||||    
42553643 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 42553693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 689 - 777
Target Start/End: Original strand, 7194965 - 7195053
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaaca-cccgaaataaacacccctaaaaacacc 777  Q
    ||||||||| |||||| ||||||||||||||   ||||||   ||||||||||||||||||| ||  ||||||||| |||||||||||||    
7194965 agacgaacaaagatcgatgaaactgagaatatagacaaaatgagtcgtttatatgcggaacatccaaaaataaaca-ccctaaaaacacc 7195053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 15916287 - 15916340
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| | |||||| ||||||||||||||| ||| |||||||||||||||||    
15916287 gctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct 15916340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||| |||| |||||||||||||||||||||| |||| |||||| || |||||||| ||||    
26071397 tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 26071458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| ||||||||||||||||||||| ||| |||||| ||||||||    
31037397 ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc 31037446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 32108926 - 32108975
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
32108926 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 32108975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 38555082 - 38555030
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||  ||||||||||||||||||| |||||||||||||||||    
38555082 gctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct 38555030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 40038614 - 40038663
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40038614 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt 40038663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 703 - 755
Target Start/End: Original strand, 4914177 - 4914229
Alignment:
703 cggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccga 755  Q
    |||||||||||||||||||||  |||| |||||| ||||||||||||| ||||    
4914177 cggtgaaactgagaatactaattaaaggtgtcgtatatatgcggaacatccga 4914229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 5904253 - 5904205
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||||||| || || ||||||||||| ||||    
5904253 cacttttgtgatgatttgcatacgtgacatatgataactgaacccattt 5904205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 11799205 - 11799286
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||  |||||||||||||| ||||    ||||| |||||| |||  |||||||||||||||||||||||| ||||    
11799205 gaaaatagtccttggccccacttttgtgataattt----acgtgacacattttaaaagaaccaattttgtagtttttggtctctgc 11799286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 20416361 - 20416413
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||||| ||||||||||||||| |||| |||||||| ||||||    
20416361 gctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc 20416413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 26071597 - 26071561
Alignment:
61 tccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||| ||||||||||||||||||||||    
26071597 tccctgcaaatatgtctcgttttggttttagtccctg 26071561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||| |||||||||||||| | |||||||||||||||||||||    
28871640 taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg 28871692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 1105075 - 1105032
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
1105075 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 1105032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 4736433 - 4736374
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  |||||||||||||||| |||| ||||||||||| || |||||||| ||||    
4736433 gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt 4736374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 9588598 - 9588559
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||| ||||||||||||||| |||||||||||||||||||    
9588598 ttttggtccctgcaaatatgtctcgttttggttttagtcc 9588559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 10830638 - 10830697
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| ||||| ||||  || |||||||| ||||    
10830638 gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt 10830697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 11935861 - 11935802
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| ||| ||||| |||||||||||| |||||| |||| |||||| |||||||||    
11935861 gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaattt 11935802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 28107918 - 28107961
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
28107918 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 28107961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 28213446 - 28213489
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| |||||||||||||||||||||||||||||| ||| ||||    
28213446 ttttggtccctgcaaatatgcctcgttttggttttggtctctgg 28213489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 28871711 - 28871754
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||| ||| |||||||||||||||||||    
28871711 ttttggtccctgcaaatatgtctcattttggttttagtccctgg 28871754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 97
Target Start/End: Original strand, 29855613 - 29855668
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||| | |||| |||| || ||||||||||| ||||||||||||||||||    
29855613 agctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg 29855668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 32108796 - 32108863
Alignment:
30 ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  || ||||||||| |||||| |||||||||||||||  ||||||| |||||| ||||||    
32108796 ttatataatttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg 32108863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 204
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||  ||||||||||||| ||||||| ||||||||||| || |||||||||    
37271597 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca 37271542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 40038495 - 40038542
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| ||||||  |||||||||||||||||||||||| |||||    
40038495 gctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta 40038542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 1286974 - 1286932
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
1286974 ttttggtccctgcaaatatgcctcattttggttttggtccctg 1286932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10830530 - 10830584
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| || ||||||||||| |||||||||||||| ||||    
10830530 gctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg 10830584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 98
Target Start/End: Complemental strand, 12145181 - 12145127
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||| |||||| ||||||||||||||| ||||||||| |||| ||| ||||    
12145181 ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg 12145127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17070536 - 17070589
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||| |||| ||||||||||||    
17070536 gctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg 17070589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 95
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||| ||||| |||| ||||||||||| ||||||||| ||||||||||    
20418013 taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc 20417963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||| |||||||||||||||||||||| ||||| |||||    
20661057 gtccctgaccccacttttgtgatgatttgcacacgtgacacat 20661099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26071292 - 26071346
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||  ||||||||||||||| ||| ||||||||||||||||||    
26071292 gctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg 26071346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | | ||||| ||||||||||||  |||||||||||||||||||||    
27916462 gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg 27916516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 28213491 - 28213541
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
28213491 cccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 28213541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||| ||||||||||||||| ||||||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagtc 31602259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 32888798 - 32888848
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||| || ||||||||||| || |||||||| ||||    
32888798 cccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 32888848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||| |||||| ||||||||||||||| ||||||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||| |||||| |||||||||||||||  ||||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 2636788 - 2636837
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
2636788 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 2636837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 5104000 - 5103951
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| || |||||||||||| ||| |||||||||||||    
5104000 gctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt 5103951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9588493 - 9588444
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||| |||| |||||||||||||| || |||||||| ||||    
9588493 ccacttttgtgataatttacatacgtggcacatgatgactgaacccattt 9588444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||| ||||||||| |||||||||||| || ||||||||||||    
18286431 taaaatatggttttagttcctgcaaatatgtcttgttttggtttta 18286476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 19685135 - 19685180
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
19685135 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 19685180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| | |||| || |||||||||||| ||||||||||||||||||    
20691094 ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc 20691045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 24443499 - 24443544
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
24443499 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 24443544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35609392 - 35609441
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
35609392 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 35609441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 36973354 - 36973403
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| ||| || |||||||| |||||||||||||||||    
36973354 gctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt 36973403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 103; Significance: 8e-51; HSPs: 180)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 33801742 - 33801557
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
33801742 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaatttttttgttttt 33801643  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33801642 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 33801557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 41 - 222
Target Start/End: Original strand, 31166869 - 31167051
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||               
31166869 aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccctgcaaaattttttgttt 31166968  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 222  Q
      ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
31166969 ttgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 31167051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 15076203 - 15076018
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
15076203 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 15076104  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
15076103 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 15076018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8680776 - 8680962
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
8680776 gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 8680875  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
8680876 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc 8680962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 7155798 - 7155983
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
7155798 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 7155897  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||  |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7155898 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 7155983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 34582530 - 34582715
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||  ||||||||||||||||||                
34582530 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttttgtttt 34582629  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
     ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34582630 tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctg 34582715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32885674 - 32885859
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
32885674 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 32885773  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||  || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32885774 gaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 32885859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14655669 - 14655584
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14655669 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 14655584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 24273939 - 24274024
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24273939 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 24274024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 15962028 - 15962214
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||  |          ||||||||||||||||||||                
15962028 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 15962127  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     | ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
15962128 tggaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttggtccctgc 15962214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 219
Target Start/End: Complemental strand, 30929043 - 30928867
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||           ||||||||||||| ||||||             |    
30929043 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttttg 30928944  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||    
30928943 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttg 30928867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 494753 - 494576
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||| ||           |||||||| |||||||||||                
494753 aagctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaaaaaaaaaattgtttttagtccctgcaaa---------att 494663  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
494662 tgaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc 494576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 543723 - 543538
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | ||||||||||||||||||||| | |||||||||||| ||||||||           ||||||||||||||||||||                
543723 gctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaattttttatttt 543624  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
     ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
543623 tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttggtccctg 543538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 37 - 227
Target Start/End: Complemental strand, 24692984 - 24692795
Alignment:
37 aactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnn 136  Q
    ||||| ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||           |||||||||||| |||||||            
24692984 aactaggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgc-aaaaaaaaattgtttttggtctctgcaaaattttttg 24692886  T
137 nnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
         ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
24692885 tttttgaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtagtttttggtctctgc 24692795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 317813 - 317995
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  ||||||||||||||||||||| |||||||||||||||| |||||           ||||||||||||||||||||                  
317813 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg--taaaaaaaattgtttttggtccctgcaaatttttttgtttttt 317910  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
317911 aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 317995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 2616134 - 2616049
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2616134 gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 2616049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 15116773 - 15116858
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
15116773 gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 15116858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17321453 - 17321368
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
17321453 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttggtccctgc 17321368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17321586 - 17321501
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
17321586 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttggtccctgc 17321501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 10091039 - 10091220
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| ||||||||||||||||||||||  ||||||||||||||||||||| |         ||||||||||||||||||||             |||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 10091137  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||| ||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||    
10091138 aatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgttccctgc 10091220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 777939 - 777853
Alignment:
142 gaaaatagtccc-tgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
777939 gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 777853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 1890062 - 1890246
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||           ||||||||||||||||||||             |    
1890062 taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 1890161  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| | |||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||    
1890162 aaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttggtccctgc 1890246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 45 - 227
Target Start/End: Complemental strand, 3356495 - 3356315
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||| |||             |||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcccta--taaaaaaaattgtttttggtccctggaaaattttttgtttttgaa 3356398  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||| |||| |||||||||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||    
3356397 aatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaattttgtcgtttttggtccctgc 3356315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 7324091 - 7324007
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||    
7324091 aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaattttgtagtttttgatccctgc 7324007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 220
Target Start/End: Complemental strand, 19296305 - 19296227
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 220  Q
    ||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
19296305 gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtagtttttgg 19296227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 11129302 - 11129387
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |||||||    
11129302 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaattttttagtttttgatccctgc 11129387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26375694 - 26375878
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||           ||||||||| ||||||||||                  
26375694 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaattgtttttgttccctgcaaaattttttgtttttt 26375793  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| | | |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||    
26375794 aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttggtccctgc 26375878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 6468570 - 6468486
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||    
6468570 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtagtttttggtccctgc 6468486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 19275939 - 19275855
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
19275939 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc 19275855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 21995167 - 21995251
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
21995167 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc 21995251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 31398440 - 31398370
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta 212  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
31398440 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta 31398370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 6591339 - 6591255
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||| |||||  ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||    
6591339 aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgatccctgc 6591255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 40 - 210
Target Start/End: Original strand, 14428648 - 14428818
Alignment:
40 taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||           ||||||||||||||||||||               
14428648 taagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgttt 14428747  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 210  Q
       ||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||    
14428748 tttaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg 14428818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 5286687 - 5286775
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggc---acattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||   ||||||||| ||||||||||||||||||||||||||||||    
5286687 gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaattttgtagtttttggtccctgc 5286775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 2373391 - 2373307
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||| | |||| |||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
2373391 aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc 2373307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 7156159 - 7156103
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
7156159 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 7156103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 12612236 - 12612172
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
12612236 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 12612172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 24274130 - 24274074
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
24274130 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 24274074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 33131626 - 33131710
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| | || | ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
33131626 aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtagtttttggtccctgc 33131710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15962388 - 15962334
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
15962388 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15962334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 543365 - 543418
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 543418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1890451 - 1890395
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||    
1890451 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt 1890395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 8681115 - 8681059
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
8681115 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 8681059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 12419937 - 12419881
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
12419937 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt 12419881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 14655380 - 14655436
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
14655380 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt 14655436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 22822650 - 22822594
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||    
22822650 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt 22822594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 23770400 - 23770336
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||| | || |||||||| |||||||||||||||||||||||    
23770400 ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttggtccctgc 23770336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 25431863 - 25431799
Alignment:
33 tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| || ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
25431863 tataaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 25431799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26375990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 494406 - 494457
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
494406 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 494457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 44 - 99
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 5286894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 176 - 227
Target Start/End: Original strand, 22822391 - 22822442
Alignment:
176 tgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||    
22822391 tgcaaacgtggcacattataactgaaccaattttgtagtttttggtccctgc 22822442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1007508 - 1007454
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
1007508 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1007454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3414388 - 3414442
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
3414388 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3414442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3969008 - 3968954
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
3969008 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3968954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19296406 - 19296352
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
19296406 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 19296352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21994402 - 21994348
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
21994402 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 21994348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21995065 - 21995119
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||    
21995065 gctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg 21995119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22543355 - 22543409
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
22543355 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22543409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
23770162 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 23770216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25137356 - 25137302
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
25137356 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25137302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30928682 - 30928736
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
30928682 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 30928736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34582891 - 34582837
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
34582891 gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg 34582837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 2615873 - 2615926
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
2615873 gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 2615926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 7324189 - 7324137
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
7324189 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 7324137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 9896537 - 9896453
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| | || |||| |||| ||||||||||||||||||||| || || |||||||| |||||||||||||||||| ||||    
9896537 aaaatagtcaccgatcccatttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtagtttttggtctctgc 9896453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 161 - 226
Target Start/End: Original strand, 11448657 - 11448726
Alignment:
161 acttttgtgatgatttgcatacgt----ggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    ||||||||||||||||||||||||    | ||||||||||||||| ||||||||||||||||||||||||    
11448657 acttttgtgatgatttgcatacgtacgtgacacattataactgaatcaattttgtagtttttggtccctg 11448726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
12176640 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 12176588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 22792898 - 22792846
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
22792898 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc 22792846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 31167199 - 31167143
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||    
31167199 gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt 31167143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 33808621 - 33808677
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||    
33808621 gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt 33808677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
34990312 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 34990260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3356143 - 3356194
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||    
3356143 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc 3356194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 12419709 - 12419760
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
12419709 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 12419760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 17771912 - 17771963
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||    
17771912 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc 17771963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1007125 - 1007179
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
1007125 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 1007179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2373180 - 2373234
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||    
2373180 gctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg 2373234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3968646 - 3968700
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
3968646 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3968700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6412219 - 6412273
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
6412219 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 6412273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6412578 - 6412524
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
6412578 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 6412524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6468311 - 6468365
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| | |||||||||||||||||||    
6468311 gctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg 6468365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10910963 - 10910909
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
10910963 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10910909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11449168 - 11449114
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||    
11449168 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg 11449114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12299139 - 12299085
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||    
12299139 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 12299085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12612358 - 12612304
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||    
12612358 gctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg 12612304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19690394 - 19690448
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
19690394 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19690448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20467717 - 20467663
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||    
20467717 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 20467663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21147405 - 21147459
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
21147405 gctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg 21147459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21385252 - 21385306
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
21385252 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 21385306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21385583 - 21385529
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
21385583 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 21385529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21995424 - 21995370
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||    
21995424 gctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg 21995370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22543717 - 22543663
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
22543717 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 22543663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23502539 - 23502485
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||    
23502539 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg 23502485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||    
24273829 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg 24273883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25136995 - 25137049
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||    
25136995 gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg 25137049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 30479438 - 30479367
Alignment:
24 atgttcttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| |||  ||||||||||| |||||| || | |||||||||||||||||||||||||||||||||    
30479438 atgttcttataaaaa--aagctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg 30479367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31198616 - 31198670
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
31198616 gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 31198670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33131849 - 33131795
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||  |||||||||||||||||||||||||||||||||    
33131849 gctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg 33131795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 13268110 - 13268163
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||||||||||||||| |||||||||||||    
13268110 gctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct 13268163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 13617584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 19321130 - 19321081
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||||||    
19321130 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 19321081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 25431672 - 25431721
Alignment:
174 tttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||| |||||||||||| ||||||||||||||||||||||||    
25431672 tttgcatacgtgacacattataactaaaccaattttgtagtttttggtcc 25431721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 777678 - 777734
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| | ||||||| ||||||||||| |||||||||||||||||||||||||    
777678 gctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt 777734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 11448538 - 11448590
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| | |||||||||||||||||||| ||||||||||||||||||||    
11448538 gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc 11448590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||  ||||| ||||||||||||||||||||||||||||||||||||||    
20467354 taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 20467406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 33808837 - 33808797
Alignment:
187 cacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||||||||||||||||||||||||||||    
33808837 cacattataactgaaccaattttgtagtttttggtccctgc 33808797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 34989961 - 34990013
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||||| | |||||||||||||||||||||||||||||| |||||||||    
34989961 agctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc 34990013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3276353 - 3276302
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||    
3276353 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 3276302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 9896636 - 9896585
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| || ||||||||||||||||    
9896636 gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 9896585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
54 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
13617804 gttttggtccctgcaaatatgcctcgttttggttttagtccctg 13617761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 19129337 - 19129392
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| |||| || ||| |||||||||||||||||||||||||||||||||||||||    
19129337 gctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg 19129392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 318096 - 318042
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| ||||||||||||||  |||||||||||||||||||||    
318096 gctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg 318042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 2616239 - 2616193
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||    
2616239 gctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3414751 - 3414697
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||| ||||||||||||||||||||||    
3414751 gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 3414697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 6591116 - 6591162
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||    
6591116 gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt 6591162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 8170150 - 8170100
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
8170150 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8170100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 12757611 - 12757661
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
12757611 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 12757661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||| ||||||||||| ||||||||||| ||||||||||||||||||    
14428948 ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc 14428898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14656259 - 14656205
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||||| ||||||||||||||||||||||    
14656259 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 14656205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18024374 - 18024320
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| || |||||||||||||||||||    
18024374 gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 18024320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19267566 - 19267620
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| |||||||| |||||||||||||||||||||    
19267566 gctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg 19267620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19296109 - 19296163
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | ||||||||||||||||||||||| |||||||| ||||||||||||    
19296109 gctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg 19296163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21993788 - 21993842
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
21993788 gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg 21993842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 23502238 - 23502284
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||    
23502238 gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 24901240 - 24901290
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
24901240 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 24901290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31186590 - 31186536
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || ||||||||||||||||||||| |||||||||||||    
31186590 gctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg 31186536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 778041 - 777992
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| ||||||| ||||||||||||||||||||||| ||||||||    
778041 gctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt 777992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 13617648 - 13617697
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| ||||||||||| ||||    
13617648 ccacttttgtgatgatttgcacacgtggcacatgataactgaacccattt 13617697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 17765010 - 17765059
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||    
17765010 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 17765059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 22822308 - 22822357
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||| |||||||||| ||||||||||||||||||    
22822308 gctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 30239294 - 30239347
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| | ||||||| |||||||||||| |||||||||||||||||||||    
30239294 gctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct 30239347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||| ||||||||| |||||||||||| |||||||||||||||||    
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt 6591392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcaca 190  Q
    |||||||||| |||| |||| ||||||||||||||||||||||||||||    
17772014 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca 17772062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||  |||||||||||||||||||||||||||||||||    
18024014 taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg 18024066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 689 - 729
Target Start/End: Original strand, 20701461 - 20701501
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaag 729  Q
    |||||||||||||||||||||||||||||||| ||||||||    
20701461 agacgaacagagatcggtgaaactgagaatacaaacaaaag 20701501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 83
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgtttt 83  Q
    ||||||||| |||||||||||||||||||||||||||||||    
23770438 gctaaaatatggttttagtccctgcaaatatgcctcgtttt 23770398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 31276341 - 31276285
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||  ||||| ||||||||||||||| ||||||||| ||||||||||||    
31276341 aagctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg 31276285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 34990213 - 34990129
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| ||||||||||||||||| || |||||||| || | |||||  ||||  |||||||||||||||||    
34990213 aaaatagtccttgatcccatttttgtgatgatttgcaaacatggcacatgatgattgaactgatttattagtttttggtccctgc 34990129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| |||||| ||||||||||||||| |||||||| ||||||||||||    
12298825 taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct 12298876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 24901347 - 24901406
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||| ||||| ||||||||||| ||||    
24901347 gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacccattt 24901406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 31398540 - 31398489
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||||||||||||||||||| ||| |||||||||||||||    
31398540 gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc 31398489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10910630 - 10910684
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| || |||||||| ||||||||||||||||||||||    
10910630 gctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg 10910684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 11129542 - 11129496
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| | ||||| |||||||||||||||||||||||||||||    
11129542 gctaaaatatgattttactccctgcaaatatgcctcgttttggtttt 11129496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13150749 - 13150695
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||| |||  ||||||||||||| ||||||||||||||||||||||    
13150749 gctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg 13150695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19129519 - 19129465
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| | ||||||||||||||||||||    
19129519 gctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg 19129465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 19276050 - 19275984
Alignment:
31 tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| |||| | |||||||  |||||||||||| ||||||| |||| ||||||||||||||||||    
19276050 tatatatactaggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctg 19275984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #147
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25121495 - 25121441
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || ||||||||||||  |||||||||||||||||||||    
25121495 gctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg 25121441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 1214995 - 1214942
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||  || ||||||||||| |||||||||||||||||||||    
1214995 gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct 1214942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||| |||||||||||||||||||||    
6564595 ttttggtccctgcaaatatgtctcgttttggttttagtccct 6564636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #150
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||| |||||||||||||| ||| |||| |||||||||||||    
9896280 ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg 9896333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #151
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 15442938 - 15442987
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| |||||||||||||| |||||||||| |||||||    
15442938 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt 15442987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||| ||| ||||||||||| ||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg 19320822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #153
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 19320886 - 19320935
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
19320886 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 19320935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 31198734 - 31198783
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
31198734 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 31198783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 689 - 776
Target Start/End: Original strand, 3880276 - 3880363
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc-cgaaataaacacccctaaaaacac 776  Q
    ||||||||||||| |||||||||||| ||||| |||||||| |  ||| |||| ||||||||||   ||||||||| ||||||||||||    
3880276 agacgaacagagaccggtgaaactgaaaatacaaacaaaaggttccgtatataagcggaacaccaaaaaataaaca-ccctaaaaacac 3880363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 6564933 - 6564893
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||| ||||||||||||||| ||||||||||||||||||    
6564933 ggttttggtccctgcaaatatgtctcgttttggttttagtc 6564893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #157
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||| ||||||||||||||| |||||||||||||||||| |||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagtctctggt 19275179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #158
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 23628797 - 23628849
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||||| |||||| ||||||||||||||   |||||||||||||||||    
23628797 aagctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc 23628849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 1007197 - 1007240
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
1007197 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 1007240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 1214767 - 1214810
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||| || ||||||||||||||||||||    
1214767 ttttggtccctgcaaatatgtcttgttttggttttagtccctgg 1214810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 12298927 - 12298986
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||||||||||||||||||||| ||||||||||| || | |||||| ||||    
12298927 gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 12298986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 78
Target Start/End: Complemental strand, 15117039 - 15117004
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctc 78  Q
    ||||||||| ||||||||||||||||||||||||||    
15117039 gctaaaatatggttttagtccctgcaaatatgcctc 15117004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 25137066 - 25137109
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
25137066 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 25137109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 31185753 - 31185796
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
31185753 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 31185796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 31198688 - 31198731
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
31198688 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 31198731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1875503 - 1875557
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  | |||| ||||||||||||||||||||||||| ||| |||||||    
1875503 gctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg 1875557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
13268182 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 13268224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14655904 - 14655958
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||||| ||||||||||||||   |||||||||||||||||||||    
14655904 gctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg 14655958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 15116674 - 15116721
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||| ||||||||||  |||||||||||||||||    
15116674 gctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt 15116721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15722611 - 15722665
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||  |||||||||| ||||||||| ||||||||||||    
15722611 gctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg 15722665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17765374 - 17765320
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| ||||||||  ||||||||||||    
17765374 gctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg 17765320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
19129447 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 19129405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #173
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 23629044 - 23628994
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||| | ||||||||||| || |||||||| ||||    
23629044 cccacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt 23628994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #174
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
24901311 ttttggtccctgcaaatatgcctcattttggttttggtccctg 24901353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 1214697 - 1214750
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||||  ||||| ||||||||||||||| | | |||||||||||||||||    
1214697 gctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct 1214750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 3968764 - 3968809
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
3968764 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 3968809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 99
Target Start/End: Original strand, 5286606 - 5286643
Alignment:
62 ccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||||||||||||||||| ||||||||| ||||    
5286606 ccctgcaaatatgcctcgttttgattttagtccttggt 5286643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 12611996 - 12612045
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| ||| ||||||||||||||||||||  ||||| ||||||||    
12611996 gctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt 12612045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #179
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 13268218 - 13268255
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtgg 186  Q
    |||||||| |||||||||||||||||||||| ||||||    
13268218 gtccctgaccccacttttgtgatgatttgcacacgtgg 13268255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #180
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||||||| |||||||||| ||||||    
17765302 ttttggtccctgcaaatatgcctcattttggttttggtccct 17765261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 103; Significance: 8e-51; HSPs: 217)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 38980252 - 38980067
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
38980252 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 38980153  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38980152 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 38980067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 37272101 - 37271916
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
37272101 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 37272002  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37272001 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 37271916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 26814228 - 26814042
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||           |||||||| |||||||||||                
26814228 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaattttttgtttt 26814129  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26814128 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 26814042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19183783 - 19183969
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||         ||  ||||||| ||||||||||                
19183783 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaattttttgtttt 19183882  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19183883 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 19183969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 23989839 - 23990022
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||| ||  |         ||||||||||||||||||||             |    
23989839 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcacta-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 23989937  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23989938 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 23990022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 3838266 - 3838077
Alignment:
40 taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnn 137  Q
    |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||           ||  ||||||||||||||||||             
3838266 taagctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgt 3838167  T
138 nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
        |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3838166 ttttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 3838077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38731830 - 38732013
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||| |         ||||||||||||||||||||                  
38731830 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 38731928  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||    
38731929 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggttcctgc 38732013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 24483632 - 24483717
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24483632 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 24483717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 44985623 - 44985807
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||           || ||||||||||| ||||||             |    
44985623 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaatttgtttttggtccatgcaaaaatttttgtttttg 44985722  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||    
44985723 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtagtttttggtccctgc 44985807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 11713844 - 11713658
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||           ||  ||||||||||||||||||                
11713844 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttgtttt 11713745  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| || ||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||    
11713744 tgaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaattttgtagtttttggtccctgc 11713658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 26707863 - 26708057
Alignment:
32 atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn 131  Q
    ||||||| || ||||||||| ||||||| ||||||||||||| | ||||||||||||||||||||| |         ||||||||||||||||||||       
26707863 atataaaataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaatt 26707961  T
132 nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
              |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||    
26707962 tgttgtttttgaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttggtctctgc 26708057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 40301976 - 40302162
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||| |||| |||||||||||||           ||  ||||||||||||||||||                
40301976 gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttgtttt 40302075  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
40302076 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtagtttttggtccctgc 40302162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 43789191 - 43789005
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||           ||||||||||||||||||||                
43789191 gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 43789092  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||    
43789091 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtagtttttggtctctgc 43789005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 24483399 - 24483584
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||| |         ||||||||||||||||||||                
24483399 aagctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttt 24483497  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      ||||||||| |||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
24483498 taaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtagtttttggtccctgc 24483584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 17541775 - 17541590
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||| ||||          ||||||||||||||||||||                 
17541775 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 17541676  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
17541675 taaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 17541590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 33732863 - 33733041
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||| ||||||||||             |    
33732863 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttgatccctgcaaaattttttgtttttg 33732960  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||| ||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33732961 aaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 33733041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 7814736 - 7814553
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||| |         |||||||||||||| |||||             |    
7814736 gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg-tcaaaaaaaattgtttttggtccccgcaaaattttttgtttttg 7814638  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
7814637 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttgatccctgc 7814553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 44073806 - 44073620
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||           ||||||||||||||||||||                
44073806 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 44073707  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| | |||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||    
44073706 tgaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttggtccctgc 44073620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 224
Target Start/End: Original strand, 20658062 - 20658242
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||| | ||||||||||||||||||||||||| ||||||||||||||||||| |         |||||||| |||||||||||             |    
20658062 gctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg-taaaaaaaaattgtttttagtccctgcaaaattttttgtttttg 20658160  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    |||||| |||||||  ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
20658161 aaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 20658242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 8046430 - 8046515
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
8046430 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 8046515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16899996 - 16900081
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
16899996 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttggtccctgc 16900081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16993387 - 16993472
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
16993387 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttggtccctgc 16993472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 43710480 - 43710565
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
43710480 gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttggtccctgc 43710565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 5790898 - 5790714
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |          ||||||||||||||||||||                 
5790898 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaattgtttttggtccctgcaaaaaaattttgtttt 5790799  T
142 -gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
5790798 tgaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt--tagtttttggtccctgc 5790714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 60 - 227
Target Start/End: Complemental strand, 22881950 - 22881784
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtccctgaacc 159  Q
    ||||||||||||||| |||||||||||||||||||||| |         ||||||||||||||||||||             ||||||||||||| | ||    
22881950 gtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctaaccc 22881852  T
160 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
22881851 cacttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtagtttttggtccctgc 22881784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7814505 - 7814420
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
7814505 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttgatccctgc 7814420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 40786561 - 40786646
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
40786561 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc 40786646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 41693901 - 41693816
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||    
41693901 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaattttttagtttttggtccctgc 41693816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 43597498 - 43597315
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||| |||||| |||||||||||||||||||||| |         ||||||||||||||||||||             |    
43597498 gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 43597400  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
43597399 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc 43597315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 26238816 - 26238994
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |         |||| |||||||||||||||             |||    
26238816 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg-taaaaaaaaattgtgtttggtccctgcaaatttttttgtttttgaa 26238914  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa-ttttgtagtttttggtcc 223  Q
    |||||||||||  |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||    
26238915 aatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttttgtagtttttggtcc 26238994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 41791119 - 41791203
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||||||||||||    
41791119 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaattaattttgtagtttttggtccctg 41791203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 1497943 - 1497758
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||| ||||||| ||| |||||||||||||||||||||||||||||||||  |          ||||||||||||||||||||                 
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttgttttt 1497844  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||   | ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
1497843 gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttttagtttttggtccctgc 1497758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 10664985 - 10665165
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||| | ||||||||||           ||||||||||||| ||||||             |    
10664985 gctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 10665084  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||| |||| ||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||    
10665085 aaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtagtttttggtcc 10665165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14393029 - 14392944
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| ||||    
14393029 gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtagtttttggtctctgc 14392944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 142 - 224
Target Start/End: Original strand, 31225817 - 31225898
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    ||||||||||| ||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
31225817 gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaattttgtagtttttggtccc 31225898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 12835427 - 12835511
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||    
12835427 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaattttata-tttttggtccctgc 12835511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 17912452 - 17912636
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnnga 143  Q
    ||||||| | |||||||||||||||||||| |||||||||||||||||| |||||          ||||||||||||||||||||             ||    
17912452 taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga 17912551  T
144 aaatagtccctgaacccacttttgtgat-gatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| |||||||||||||| || ||||||||| | ||||||||||||||||||||||||||||||||  |||||||    
17912552 aaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaattttgtagtttttaatccctgc 17912636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 25954325 - 25954240
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| |  ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||| |||||    
25954325 gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtagtttttggttcctgc 25954240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29865510 - 29865326
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||           ||||||||||||||||||||             |    
29865510 gctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaatttgtttttggtccctgcaaaattttttgtttttg 29865411  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| || | |  ||||||||||||||||||||||||| |||||||  |||||||||||||| |||||||||||||||||    
29865410 aaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaattttatagtttttggtccctgc 29865326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32691314 - 32691498
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||  ||||||||||||||||||||||||||| ||||||           ||||||||||||| ||||||             |    
32691314 gctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaaattgtttttggtccttgcaaatttttttgtttttg 32691413  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||| |||||||| |||| ||||||||||||||||||||||||||| | || |||||||| |||||||||||||||||||||||    
32691414 aaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttggtccctgc 32691498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 45442415 - 45442499
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||| ||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
45442415 aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 45442499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 19831694 - 19831609
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||    
19831694 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttggtccctgc 19831609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 43592146 - 43592231
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||| || | ||||||  ||||||||||||||||||||||    
43592146 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtagtttttggtccctgc 43592231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 10375068 - 10374891
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||            |||||||||||||||||||             |    
10375068 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg---taaaaaaaatgtttttggtccctgcaaaatttgttgtttttg 10374972  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggc-acattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||     ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
10374971 aaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaattttgtagtttttggtccctgc 10374891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 16900205 - 16900149
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
16900205 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 16900149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 16993596 - 16993540
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
16993596 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 16993540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19184150 - 19184094
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
19184150 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 19184094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 37271740 - 37271796
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
37271740 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 37271796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24483890 - 24483836
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
24483890 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 24483836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 5790559 - 5790615
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
5790559 gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt 5790615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 17541383 - 17541439
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||    
17541383 gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 17541439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 26813867 - 26813923
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
26813867 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 26813923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 31326149 - 31326066
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||||  || |||||||||||||||||||||||    
31326149 aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtagtttttggtccctgc 31326066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||    
42358702 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 42358754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 43788859 - 43788915
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
43788859 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt 43788915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 22881614 - 22881665
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
22881614 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 22881665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2481556 - 2481502
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
2481556 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2481502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 3671187 - 3671137
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||    
3671187 aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 3671137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4423896 - 4423950
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
4423896 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 4423950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5334752 - 5334806
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
5334752 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5335039 - 5334985
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
5335039 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8046330 - 8046384
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||    
8046330 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 8046384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8046647 - 8046593
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
8046647 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 8046593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9195205 - 9195151
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
9195205 gctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg 9195151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 10374829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11713486 - 11713540
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
11713486 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 11713540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11788415 - 11788361
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
11788415 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 11788361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14003741 - 14003687
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
14003741 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 14003687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15842822 - 15842768
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
15842822 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16522992 - 16523046
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
16522992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16523046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16523324 - 16523270
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
16523324 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16523270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20131680 - 20131626
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
20131680 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20131626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24358617 - 24358671
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24358617 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24358671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25705448 - 25705394
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
25705448 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25705394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29859871 - 29859817
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
29859871 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 29865276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 36622251 - 36622305
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
36622251 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 36622305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 128
Target Start/End: Original strand, 38639413 - 38639498
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa 128  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||         ||||||||||||||||||||    
38639413 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaattgtttttggtccctgcaaa 38639498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40302338 - 40302284
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
40302338 gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 40302284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41694002 - 41693948
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
41694002 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 41693948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43592047 - 43592101
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
43592047 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 43592101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43597155 - 43597209
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||    
43597155 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 43597209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 146328 - 146381
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
146328 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 146381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 27311068 - 27311015
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||    
27311068 gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct 27311015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 33733240 - 33733187
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||    
33733240 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct 33733187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 7814247 - 7814303
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||||||||  ||||||||||||| ||||||||||||||||||||||||||||||||    
7814247 gctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt 7814303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
15842464 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
29859490 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 10671940 - 10671889
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
10671940 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 10671889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 13215056 - 13215115
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13215056 actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13215115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1497611 - 1497665
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||    
1497611 gctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg 1497665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3671004 - 3671058
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||    
3671004 gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg 3671058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4424184 - 4424130
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
4424184 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4424130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9195055 - 9195109
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
9195055 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 9195109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12835326 - 12835380
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||| ||||||||||||||||||    
12835326 gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg 12835380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14003410 - 14003464
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
14003410 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 14003464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16673770 - 16673716
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
16673770 gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg 16673716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 17912808 - 17912754
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||    
17912808 taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggt 17912754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18113090 - 18113144
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||| |||||||||||||||||||    
18113090 gctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg 18113144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20131318 - 20131372
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
20131318 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20131372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20939270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24358944 - 24358890
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
24358944 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24358890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25705086 - 25705140
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
25705086 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25705140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26239159 - 26239105
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
26239159 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 26239105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27310877 - 27310930
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||    
27310877 gctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg 27310930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30215423 - 30215477
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
30215423 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 30215477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31226076 - 31226022
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||    
31226076 gctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg 31226022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33576116 - 33576062
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
33576116 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33576062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 34317799 - 34317853
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
34317799 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 34317853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41451838 - 41451892
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
41451838 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 41451892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41693675 - 41693729
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||  |||||||||||||||||||||    
41693675 gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 41693729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44559063 - 44559117
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
44559063 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 44559117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44985983 - 44985929
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||    
44985983 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 44985929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| |||||||||||||||||||||||||||||| |||||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 1138036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 27109074 - 27109127
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |||||| ||||||||||||||||||||||||||||||    
27109074 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct 27109127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||    
41791020 ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg 41791073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 42695869 - 42695922
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||||    
42695869 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct 42695922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 42696204 - 42696151
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||| ||||||  ||||||||||||||||||||||||||||||||||    
42696204 aagctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc 42696151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||||| ||||||||||| |||||||||||||||||||    
16968555 taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg 16968607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||| |||||||||||||||||||| ||||||||||||    
25954423 taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg 25954371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||| ||||||||||||||||||||||| ||||||||||||||||    
36622582 ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 36622534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 44993957 - 44993881
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || || ||||  |||| ||||||||||    
44993957 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtagtttttg 44993881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 4042611 - 4042662
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||  ||||||||||||||||||||||||||||||||||    
4042611 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc 4042662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 36806892 - 36806841
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
36806892 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 36806841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 146689 - 146635
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||  |||||||||||||||||||||    
146689 gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 146635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2265396 - 2265342
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | ||||||||| |||||||||| ||||||||||||||||||||||    
2265396 gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg 2265342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3837934 - 3837988
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||||||||||| |||||||| |||||||||||||    
3837934 gctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg 3837988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4794131 - 4794185
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
4794131 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 4794185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10671631 - 10671685
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||  ||||||||||||||||||||||    
10671631 gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 10671685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 13337667 - 13337578
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    ||||||||||||| ||||||||| |||||||| ||||||||  ||||| |||| | |||||||| | ||||||||| ||||||||||||||    
13337667 agacgaacagagaccggtgaaacagagaatacaaacaaaaggcgtcgtatataggtggaacacctgaaaataaaca-ccctaaaaacaccc 13337578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16673412 - 16673466
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
16673412 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 16673466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17302142 - 17302088
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||||||||||| ||||||||||||||||||||||    
17302142 gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 17302088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31225716 - 31225770
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||    
31225716 gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg 31225770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31325921 - 31325975
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||    
31325921 gctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg 31325975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31326251 - 31326197
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||||||| ||||||||||||||||||| |||||||||||||    
31326251 gctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg 31326197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31644842 - 31644892
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
31644842 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 31644892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32476096 - 32476150
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||| ||||||||||||||||||    
32476096 gctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg 32476150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33575753 - 33575807
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
33575753 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 33575807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
48 aatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||| |||||||||||||||||||||| |||||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 35155344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37911119 - 37911065
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||| ||||||    
37911119 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg 37911065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40124967 - 40125021
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||| ||||    
40124967 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg 40125021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40786461 - 40786515
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| || ||||||||||| ||||||||||||||||||||||    
40786461 gctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg 40786515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 41791311 - 41791261
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||| ||||    
41791311 gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc 41791261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43710707 - 43710653
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||| || |||||||||||||||||||||||||||||||||    
43710707 gctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg 43710653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 38979890 - 38979947
Alignment:
43 gctaaaatacggttttagtccctgcaaatat-gcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||   ||||||||||||||||||||||||    
38979890 gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt 38979947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 689 - 742
Target Start/End: Complemental strand, 42802503 - 42802450
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatat 742  Q
    ||||||||||||||| |||||||||||||||| |||||||| |||||| |||||    
42802503 agacgaacagagatcagtgaaactgagaatacaaacaaaaggtgtcgtatatat 42802450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| |||||| ||||||||||||||| ||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 44559358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| ||||||||||| |||||||||| ||||||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 23990145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 36622349 - 36622432
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| |||||||||||||||||||| || ||||| || || ||||| ||||| |||||||||||| ||||    
36622349 aaaatagtccatgaccccatttttgtgatgatttgcatac-tgccacatgatgacggaaccgattttatagtttttggtctctgc 36622432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3172021 - 3172072
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| ||||||||||||||||||| |||||||||||||||    
3172021 gctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc 3172072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3172531 - 3172480
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| |||| ||||||||||||||||||||||||||||||    
3172531 gctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc 3172480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 4042889 - 4042838
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||  ||||||||||||||| |||||||||||||||||||    
4042889 gctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc 4042838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 90
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||||||||||||||||||||||||||||    
16900135 ttttagtccctgcaaatatgcctcgttttggtttta 16900100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 90
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||||||||||||||||||||||||||||    
16993526 ttttagtccctgcaaatatgcctcgttttggtttta 16993491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 20939216 - 20939157
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| ||||||||||||||||||| || ||||||||||| || |||||||| ||||    
20939216 gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 20939157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 23732220 - 23732161
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
23732220 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 23732161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 25954116 - 25954167
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||||||||||||||||||  ||||||||||||||||||    
25954116 gctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc 25954167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 34318082 - 34318031
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||| |||||||||||||||||| |||||||||    
34318082 gctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc 34318031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 45442695 - 45442644
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||||||| |||||||||| |||||||||||||||||||    
45442695 gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc 45442644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1138358 - 1138304
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| |||||||| |||||||||||||    
1138358 gctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg 1138304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2481194 - 2481248
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || | |||||||||| ||||||||||||||||||||||    
2481194 gctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg 2481248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10665293 - 10665239
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||| |||||||||||| |||||||||||||||| ||||    
10665293 gctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg 10665239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18113453 - 18113399
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| ||||||||| |||||||||||||| ||||||    
18113453 gctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg 18113399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23732327 - 23732274
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| |||||||||||||||||||||| |||||||||||    
23732327 gctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg 23732274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30215870 - 30215816
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||  | ||||||||||||||||||||    
30215870 gctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg 30215816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 31909477 - 31909428
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||    
31909477 gctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc 31909428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34964158 - 34964104
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||| ||||||| |||||    
34964158 gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg 34964104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36815834 - 36815780
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||||| ||||||||||||||||| ||||    
36815834 gctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg 36815780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 37228734 - 37228784
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| |||||||||||||||  |||||||||||||||||    
37228734 gctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc 37228784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40125288 - 40125234
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||| |||| |||||||||||||    
40125288 gctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg 40125234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43671935 - 43671989
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| |||||||| |||||||||||||||| ||||    
43671935 gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg 43671989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 44994060 - 44994010
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||| |||||||||||||| |||||||| |||||||||    
44994060 gctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc 44994010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||| || |||||||||||||||||||||| ||||||||||| || |||||||    
1138091 gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 1138144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 4424014 - 4424063
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
4424014 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4424063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |  |||||||||||| |||||||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct 4842918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16523108 - 16523157
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
16523108 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16523157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||| ||| |||||||||||||||||||||| ||||||||||| || |||||||    
25750857 gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 25750804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 27109161 - 27109210
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
27109161 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 27109210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 98
Target Start/End: Complemental strand, 33576075 - 33576030
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||||    
33576075 ggttttagtccctgcaaatatgtctcattttggttttggtccctgg 33576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 40125085 - 40125134
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40125085 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40125134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 43710394 - 43710435
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
43710394 ttttagtcccttcaaatatgtctcgttttggttttagtccct 43710435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #182
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| |||||||||||||||  |||||||||||||||||    
3832634 taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 3832586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| || ||||||||||||| |||||||||||||||||    
13850881 taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc 13850833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #184
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 689 - 757
Target Start/End: Original strand, 33788289 - 33788357
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaa 757  Q
    ||||||||||||| |||||| || |||||||| ||| ||||  | ||| ||||||||||||||||||||    
33788289 agacgaacagagaccggtgataccgagaatacaaactaaaggcgccgtatatatgcggaacacccgaaa 33788357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4423968 - 4424011
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
4423968 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 4424011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4794203 - 4794246
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
4794203 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 4794246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4842940 - 4842999
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  |||||||||||||||||| || ||||||||||| || |||||||| ||||    
4842940 gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacccattt 4842999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 16523062 - 16523105
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||||||| |||||| ||||||||    
16523062 ttttggtccctgcaaatatgcctcgtttaggttttggtccctgg 16523105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 23732040 - 23732091
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||  |||||||||||||| |||||||||||||||||||    
23732040 gctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc 23732091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 26708184 - 26708149
Alignment:
62 ccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| ||||||||||||||||||||||||    
26708184 ccctgcaaatacgcctcgttttggttttagtccctg 26708149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 93
Target Start/End: Original strand, 26709692 - 26709747
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||| ||||||||| | ||||||| |||||||||||| ||||||||||| ||||||    
26709692 actaggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc 26709747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 31909370 - 31909311
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
31909370 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 31909311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 331
Target Start/End: Original strand, 33733217 - 33733252
Alignment:
296 cagggactaaaaccatattttagccaataaactata 331  Q
    ||||||||||||||||||||||||||||||| ||||    
33733217 cagggactaaaaccatattttagccaataaaatata 33733252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 689 - 752
Target Start/End: Complemental strand, 34230617 - 34230555
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc 752  Q
    ||||||||||||||||||| ||||| |||||| ||||||||| | ||| |||| ||||||||||    
34230617 agacgaacagagatcggtg-aactgcgaatacaaacaaaagacgccgtatataggcggaacacc 34230555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 43672041 - 43672100
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||||||||||||| ||||||| ||||||||||| || |||||||| ||||    
43672041 gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacccattt 43672100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 45442317 - 45442364
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||||||| ||||||||||| ||||||||| |||||    
45442317 gctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 3832389 - 3832439
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
3832389 cccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 3832439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 93
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||| |||||| |||||| |||||||| ||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagtc 4794422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Original strand, 5790875 - 5790905
Alignment:
296 cagggactaaaaccatattttagccaataaa 326  Q
    |||||||||||||||||||||||||||||||    
5790875 cagggactaaaaccatattttagccaataaa 5790905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 13215364 - 13215318
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| || ||| ||||||||||||||| ||||||||||||||    
13215364 gctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt 13215318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 14393115 - 14393077
Alignment:
56 tttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||| |||||||||||| |||||||||||||||||||    
14393115 tttagttcctgcaaatatgtctcgttttggttttagtcc 14393077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 20658408 - 20658362
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| ||||||| |||||||||||||| ||||||||| ||||    
20658408 gctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt 20658362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    |||| ||||||||||||||||||||||||||||||    
29831885 ttttggtccctgcaaatatgcctcgttttggtttt 29831919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 34317916 - 34317966
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
34317916 cccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 34317966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35155618 - 35155564
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||| || |||||| ||||||||||||    
35155618 gctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg 35155564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 35686223 - 35686173
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| |||| |||||| || |||||||| ||||    
35686223 cccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 35686173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37910757 - 37910811
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||| |||||||||||||| |||| |||||||||||||    
37910757 gctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg 37910811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 38732120 - 38732078
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||| ||||||||| ||||||||||||||| ||||||    
38732120 ttttagtcccagcaaatatggctcgttttggttttaatccctg 38732078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 41113404 - 41113494
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    ||||||| ||||| |||||||||||||||||| ||| |||||  | || |||| |||||||| ||| ||||||| ||||  ||||||||||    
41113404 agacgaaaagagaccggtgaaactgagaatacaaactaaagacattgtatataggcggaacatccgaaaataaataccctaaaaaacaccc 41113494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43672317 - 43672263
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||||||||||||||  | |||||||||||||||||||    
43672317 gctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg 43672263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 2481312 - 2481357
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
2481312 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 2481357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 781
Target Start/End: Complemental strand, 4975162 - 4975069
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacacccttg 781  Q
    |||||||||||||   |||||||| ||||||| ||| ||||  ||||| |||| || ||||||||| ||||||||||||  ||||||| |||||    
4975162 agacgaacagagactagtgaaactaagaatacaaactaaaggcgtcgtatataggctgaacacccgaaaataaacaccctgaaaaacatccttg 4975069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #213
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 781
Target Start/End: Complemental strand, 4993070 - 4992977
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacacccttg 781  Q
    |||||||||||||   |||||||| ||||||| ||| ||||  ||||| |||| || ||||||||| ||||||||||||  ||||||| |||||    
4993070 agacgaacagagactagtgaaactaagaatacaaactaaaggcgtcgtatataggctgaacacccgaaaataaacaccctgaaaaacatccttg 4992977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #214
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 10671749 - 10671798
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
10671749 ccacttttctgatgatttgcacacgtggcacatgatgactgaacccattt 10671798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #215
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| | |||| ||||||||||||||| ||||||||  ||||||||||||    
25299747 ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg 25299800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #216
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 41451956 - 41452001
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
41451956 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 41452001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #217
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||| |||||| |||||||||| ||||||||||||||| ||||||    
44993806 ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg 44993858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 103; Significance: 8e-51; HSPs: 253)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 18473273 - 18473458
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
18473273 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 18473372  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18473373 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 18473458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 32729048 - 32728863
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
32729048 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 32728949  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32728948 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 32728863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 7001896 - 7001710
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
7001896 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtttt 7001797  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
7001796 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc 7001710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 14007490 - 14007673
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |         ||||||||||||||||||||             |    
14007490 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaatttttagtttttg 14007588  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||    
14007589 aaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtagtttttggtccctgc 14007673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 31258340 - 31258526
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
31258340 gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtttt 31258439  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
31258440 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 31258526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 12361012 - 12361197
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||           || |||||| |||||||||||                 
12361012 gctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagtttgtttttcgtccctgcaaaattttttgtttat 12361111  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12361112 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 12361197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41358662 - 41358477
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||         || ||||||||||||||||||                 
41358662 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggtttt 41358563  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||    
41358562 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttctagtccctgc 41358477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 3679627 - 3679810
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |         |||||| |||||| ||||||             |    
3679627 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttctggtccttgcaaaaatttttgtttttg 3679725  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
3679726 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 3679810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19622656 - 19622842
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||           ||||||||||||||||||||                
19622656 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 19622755  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
19622756 tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 19622842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26061957 - 26062143
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||           || |||||||||||||||||                
26061957 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaattttttgtttt 26062056  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
26062057 tgaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc 26062143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45290458 - 45290643
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||          |||||||||||||| |||||                 
45290458 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtcccagcaaaattttttgttttt 45290557  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
45290558 taaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 45290643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 22919685 - 22919868
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |         ||||||||||||| ||||||             |    
22919685 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 22919783  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
22919784 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 22919868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 224
Target Start/End: Complemental strand, 48956065 - 48955882
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||           ||  ||||||||||||||||||                
48956065 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttt 48955966  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
     |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48955965 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 48955882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 41881094 - 41881280
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgt--ttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||         || |  ||||||||||||||||                
41881094 gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaaatttttgtttt 41881193  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||    
41881194 tgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttggtccctgc 41881280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 24649351 - 24649536
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||           || |||||||| |||||||||                 
24649351 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctgaaaaaaaaaaatttgtttttggcccctgcaaaattttttgttttt 24649450  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24649451 taaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 24649536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13259989 - 13260172
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||| ||||||||||| |||||||||||||||||||||| |         ||||||||| |||||| |||             |    
13259989 gctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg-taaaaaaaaattgtttttgttccctgtaaaattttttgtttatg 13260087  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
13260088 aaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 13260172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 33379889 - 33380073
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||                  
33379889 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 33379988  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||    
33379989 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtagtttttggtccctgc 33380073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 35308110 - 35307928
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||  ||||||||||||| ||||                
35308110 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaattttttgtttt 35308011  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35308010 tgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 35307928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 210
Target Start/End: Original strand, 990089 - 990256
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
990089 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa--tttttgtttt 990186  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 210  Q
     ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
990187 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 990256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 4323827 - 4324015
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnn 138  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||           ||  |||||| |||||||||||              
4323827 aagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaattttttgtt 4323926  T
139 nnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
       ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||    
4323927 tttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttatagtttttggtccctgc 4324015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 32454293 - 32454104
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn 137  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||                ||||||||||||||||||||             
32454293 gctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttgt 32454194  T
138 nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
        ||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
32454193 ttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 32454104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 2733285 - 2733370
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2733285 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 2733370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 21383105 - 21383288
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||| |||||| |||||||||||||||||||||| |          |||||||||||||||||||             |    
21383105 gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg-taaaaataaaatgtttttggtccctgcaaaattttttgtttttg 21383203  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| | |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
21383204 aaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc 21383288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 21391276 - 21391192
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
21391276 gaaaatagtccctga-cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 21391192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26191360 - 26191544
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||           ||||||||||||| ||||||             |    
26191360 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 26191459  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
26191460 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 26191544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 32626792 - 32626707
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
32626792 gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtagtttttggtccctgc 32626707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 18302281 - 18302197
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18302281 aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 18302197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 210
Target Start/End: Complemental strand, 44641431 - 44641266
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |         |||||||||||||||| |||             |    
44641431 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgtaaaattttttgtttttg 44641333  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 210  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
44641332 aaaatagtccctga-cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 44641266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29688427 - 29688246
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||                  
29688427 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct---taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 29688331  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||    
29688330 aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccatttttttagtttttgttccctgc 29688246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 45 - 226
Target Start/End: Complemental strand, 18900130 - 18899950
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||||||||           ||||||||||||||||||||              ||    
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaaattgtttttggtccctgcaaaattttttgttttt-aa 18900032  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    |||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||    
18900031 aatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctg 18899950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 10552212 - 10552127
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||  |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
10552212 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc 10552127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17984595 - 17984510
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| | ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
17984595 gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 17984510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 35005491 - 35005571
Alignment:
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35005491 tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 35005571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13770490 - 13770675
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           || ||||||||||| ||||||                 
13770490 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccttgcaaaattttttgttttt 13770589  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||| |  |||||||| |||||||||||||| ||||||||    
13770590 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtagtttttagtccctgc 13770675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 1159739 - 1159654
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||    
1159739 gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtagtttttgatccctgc 1159654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 34383047 - 34383132
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||  ||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
34383047 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttggtccctgc 34383132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 52254184 - 52254367
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||| || |         ||||||||||||||||||||                  
52254184 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttg-taaaaaaaaattgtttttggtccctgcaaatttttttatttttt 52254282  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| |||| | |||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
52254283 aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 52254367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 45 - 211
Target Start/End: Complemental strand, 15335292 - 15335124
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||| | |||||||||||||||||||||||||||||||||||||| ||||           ||  ||||||||||||||||||             |    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttttg 15335193  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 211  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
15335192 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 15335124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 50429208 - 50429024
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||           || ||||||||| ||||||||                 
50429208 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggttcctgcaaaattttttgttttt 50429109  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||| |||||||||||| |||||| ||||||||||||||||||  |||||||||||||||||||||    
50429108 gaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaaccagctttgtagtttttggtccctgc 50429024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 4360370 - 4360451
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    |||||||||||||| | |||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||    
4360370 aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaattttatagtttttggtccc 4360451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7819001 - 7818916
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |  | | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
7819001 gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtttttggtccctgc 7818916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 11822005 - 11822181
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||           ||||||||||||| ||||||             |    
11822005 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 11822104  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    ||| ||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||    
11822105 aaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttg 11822181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 26442898 - 26442714
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||           ||  |||||||||||||||| |                
26442898 gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcacaattttttgtttt 26442799  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||  |  ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||    
26442798 tgaaaatagtcccaca--ccacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtagtttttggtccctgc 26442714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 46868329 - 46868413
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
46868329 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc 46868413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 35 - 227
Target Start/End: Original strand, 3753206 - 3753397
Alignment:
35 taaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnn 134  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||          
3753206 taaaataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttt 3753303  T
135 nnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttggtccctgc 227  Q
            ||||| |||| ||| |||| ||||||||||||||||||||||||  ||| || |||||| ||| ||||||||||||||||||||||    
3753304 tgttttttaaaatggtccttgaccccatttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttttgtagtttttggtccctgc 3753397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 1811170 - 1811085
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||  ||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
1811170 gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc 1811085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 20756120 - 20756205
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| || | ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||||||||||    
20756120 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc 20756205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 166 - 227
Target Start/End: Original strand, 49226361 - 49226422
Alignment:
166 tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
49226361 tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtctctgc 49226422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 16083154 - 16083234
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||  |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||    
16083154 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtcc 16083234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29072498 - 29072684
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||                
29072498 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 29072597  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      |||||||||||||| |||| ||||||||||||| ||||||||||||||  || |||| ||| |||||||| ||||||||||||||    
29072598 ttaaaatagtccctgaccccatttttgtgatgattcgcatacgtggcacaagatgactggacccattttgtaatttttggtccctgc 29072684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 34808296 - 34808380
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||  ||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
34808296 aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtagtttttggtccctgc 34808380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 48609493 - 48609409
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||||||||||    
48609493 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtagtttttggtccctgc 48609409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 990378 - 990322
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
990378 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 990322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 27521575 - 27521760
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||           ||||||||||| ||||||||                
27521575 aagctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggttcctgcaaaattttttgtttt 27521674  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataac--tgaaccaattttgtagtttttggtccct 225  Q
      |||||||||||||| | || ||||||||||||||||||||||||||||| || ||  |||||| |||||||||||||||||||||    
27521675 t-aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtagtttttggtccct 27521760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 37545850 - 37545766
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| || |||| ||||||||| ||||||||||||| ||||| || |||||||| |||||||||||||||||||||||    
37545850 aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtagtttttggtccctgc 37545766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 41358370 - 41358426
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41358370 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41358426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 41 - 96
Target Start/End: Original strand, 44641077 - 44641132
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
44641077 aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 44641132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1810928 - 1810982
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
1810928 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 1810982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18302386 - 18302332
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
18302386 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18302332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 128
Target Start/End: Complemental strand, 19623016 - 19622931
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa 128  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||    
19623016 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgtttttggtccctgcaaa 19622931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 33067629 - 33067559
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||| || |||||||| |||||||||    
33067629 aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 33067559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45368491 - 45368545
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
45368491 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 45368545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 18473594 - 18473541
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
18473594 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 18473541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 144 - 224
Target Start/End: Complemental strand, 22953454 - 22953374
Alignment:
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    ||||||||||||  || |||||||||||||||| |||||||| || ||||||||| ||||||||||||||||||| |||||    
22953454 aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaattttgtagtttttagtccc 22953374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 39303874 - 39303810
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||| || |||||| | |||||||||||||||||||||||    
39303874 ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtagtttttggtccctgc 39303810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 45290819 - 45290763
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||    
45290819 gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 45290763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 35005743 - 35005692
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
35005743 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 35005692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3753571 - 3753517
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
3753571 gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 3753517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6567495 - 6567441
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
6567495 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 6567441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13260320 - 13260266
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
13260320 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13260266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21391097 - 21391151
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
21391097 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 21391151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24507842 - 24507788
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24507842 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24507788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24653803 - 24653857
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24653803 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24653857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 26142521 - 26142596
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    ||||||||||||||| |||||||||||||||||||||        ||||||||||||||||||||||||| |||||||||||||    
26142521 gaaaatagtccctgaccccacttttgtgatgatttgc--------cacattataactgaaccaattttgttgtttttggtccct 26142596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29072861 - 29072807
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||    
29072861 gctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg 29072807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt 31258645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33045689 - 33045635
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
33045689 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 33045635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35005445 - 35005499
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||    
35005445 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 35005499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35307716 - 35307770
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||    
35307716 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 35307770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37545629 - 37545683
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
37545629 gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg 37545683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38151211 - 38151157
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
38151211 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38151157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38164294 - 38164240
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
38164294 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38164240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 44157750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47819233 - 47819287
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
47819233 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47819595 - 47819541
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
47819595 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 50799131 - 50799185
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||    
50799131 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 50799185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52254478 - 52254424
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||    
52254478 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 52254424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
3247559 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3247507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
38163934 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38163986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||||||    
24649656 aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 24649605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 26191733 - 26191682
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
26191733 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 26191682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 26442564 - 26442615
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
26442564 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 26442615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 218
Target Start/End: Complemental strand, 45368847 - 45368674
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga 143  Q
    |||||||| | |||||||| ||||||||||||||||||||||||||||||||| ||         || |||||||||||||||||              |    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaattatttttggtccctgcaaaaattttcgtttttta 45368749  T
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 218  Q
    ||||||||||||| |||| ||||||||||||||||||| ||| ||||  || |||||||  ||||||||||||||    
45368748 aaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtagttttt 45368674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 98
Target Start/End: Complemental strand, 46868576 - 46868521
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||    
46868576 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg 46868521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||| |||||||||||||||||||||||||||||||||||||    
2939934 aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 2939984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3247199 - 3247253
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
3247199 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3247253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3679985 - 3679931
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||| ||||||||||||    
3679985 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg 3679931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 7818782 - 7818832
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||    
7818782 agctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 7818832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8140435 - 8140489
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
8140435 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8140489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8140798 - 8140744
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||||||||||||||||||||||||||||||||||    
8140798 gctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg 8140744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10631165 - 10631219
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
10631165 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10631219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10631527 - 10631473
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
10631527 gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 10631473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11822364 - 11822310
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
11822364 gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg 11822310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12158691 - 12158745
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| |||||||||||| |||||||||||||||||||||    
12158691 gctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg 12158745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12360967 - 12360913
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
12360967 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12360913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15516583 - 15516637
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||| |||||||||||||||||||    
15516583 gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg 15516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15526361 - 15526307
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
15526361 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 15526307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16026937 - 16026883
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
16026937 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16026883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16060884 - 16060830
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
16060884 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16060830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 17984334 - 17984384
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||||||    
17984334 gctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc 17984384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 17984700 - 17984650
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||    
17984700 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 17984650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18079399 - 18079453
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||| |||| |||||||||||||| ||||||||||||||||||    
18079399 gctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg 18079453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19720713 - 19720767
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
19720713 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19720767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24507480 - 24507534
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
24507480 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24977779 - 24977833
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
24977779 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 24977833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26324586 - 26324640
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
26324586 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 26324640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 93
Target Start/End: Complemental strand, 26324958 - 26324896
Alignment:
31 tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| || ||||||||| | ||||||||| |||||||||||||||||||||||||||||    
26324958 tatataaaataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc 26324896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30322930 - 30322984
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
30322930 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 30322984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30323292 - 30323238
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
30323292 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 30323238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32626530 - 32626584
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
32626530 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 32626584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33000306 - 33000360
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
33000306 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 33000360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33000668 - 33000614
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
33000668 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33000614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33234547 - 33234601
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
33234547 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 33234601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34002939 - 34002885
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| || |||||||||||||||||||    
34002939 gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 34002885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35056531 - 35056585
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35056531 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35056585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35056893 - 35056839
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
35056893 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 35056839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38136980 - 38136926
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
38136980 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 38136926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||    
39303675 gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg 39303729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39747834 - 39747780
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
39747834 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 39747780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40718111 - 40718165
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
40718111 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 40718165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45380273 - 45380327
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
45380273 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45380327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45380635 - 45380581
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
45380635 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 45380581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45638581 - 45638635
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
45638581 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 45638635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 48609237 - 48609291
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||    
48609237 gctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg 48609291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 48609593 - 48609543
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||    
48609593 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 48609543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 48955715 - 48955765
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||    
48955715 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 48955765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4789363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 10887597 - 10887544
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||||    
10887597 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct 10887544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 44158041 - 44157988
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |||||||||||||||||| ||||||||||||||||||    
44158041 gctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct 44157988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
18899842 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 18899894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 19721019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 22953555 - 22953507
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag 91  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||    
22953555 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag 22953507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 32420097 - 32420153
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| |||||| |||| |||||||||| ||||||||||||||||||||||    
32420097 aagctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 32420153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 34808200 - 34808252
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||||| |||||||| ||||||||||||||||||||||    
34808200 taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg 34808252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
38150851 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 38150903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 48730509 - 48730445
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||| |||||||||||||||||||||| ||||| ||||| || |||||||| |||||||||    
48730509 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtag 48730445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 53 - 96
Target Start/End: Original strand, 292870 - 292913
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
292870 ggttttagtccctgcaaatatgcctcgttttgcttttagtccct 292913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc 15058470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 18079517 - 18079572
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||||||||||| ||||||||||| || |||||||| |||||||||    
18079517 cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag 18079572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 22919976 - 22919925
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||| |||||||||||||||||||| ||||||||||    
22919976 gctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc 22919925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 37624747 - 37624798
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||| ||||    
37624747 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc 37624798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    |||||||| |||||| |||||||||||||||| |||||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc 46183737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7819102 - 7819048
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| || |||||||||||||||||||||||||||||| |||    
7819102 gctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctg 7819048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7867130 - 7867184
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||| |||||||| |||||||||||||    
7867130 gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg 7867184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 9313004 - 9313093
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    ||||||||||||| |||||||||| | ||||| | ||||||  ||||| |||| |||||||||||| ||||||||| ||||||||||||||    
9313004 agacgaacagagaccggtgaaacttataatacaatcaaaaggcgtcgtatataggcggaacacccgaaaataaaca-ccctaaaaacaccc 9313093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10887234 - 10887288
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||  |||||||||||||||||||||    
10887234 gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 10887288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12322969 - 12322915
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||||    
12322969 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg 12322915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 97
Target Start/End: Original strand, 17129682 - 17129744
Alignment:
35 taaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||| |||||||| ||||||  | |||||||||||||||||||||||||||||||||||    
17129682 taaattaaactaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg 17129744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24654166 - 24654112
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||| |||||    
24654166 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg 24654112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 648 - 777
Target Start/End: Complemental strand, 27102633 - 27102511
Alignment:
648 agcaaattttattaaacaaccagaac-ctgttcaccctgttcagacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcgg 746  Q
    |||||||||||||||||||||||| | |||||||        ||||||||| |||  |||||| |||||||||| |||||||| || ||| |||| ||||    
27102633 agcaaattttattaaacaaccagatctctgttca--------agacgaacaaagactggtgaacctgagaatacaaacaaaaggtgccgtatataggcgg 27102542  T
747 aacacccg-aaataaacacccctaaaaacacc 777  Q
    |||||||| ||||||||| |||||||||||||    
27102541 aacacccgaaaataaaca-ccctaaaaacacc 27102511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31060788 - 31060842
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| || |||||||||||||||||||    
31060788 gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 31060842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33045356 - 33045410
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  |||||| |||||||||||||||||| |||||||||||||||||||    
33045356 gctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg 33045410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33234911 - 33234857
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||| ||||||||||||    
33234911 gctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg 33234857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41738797 - 41738851
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| |||| |||||||||||||    
41738797 gctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg 41738851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| |||||||||||||||||||||| ||| |||||||||||||||    
7350426 taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc 7350475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 84
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttg 84  Q
    ||||||||| ||||||||||||||||||||||||||||||||    
18079659 gctaaaatatggttttagtccctgcaaatatgcctcgttttg 18079618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| |||| |||||||||| ||||||||||||||||||||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 26207333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 39025380 - 39025328
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||| |||||||||||||||||||||||||    
39025380 gctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct 39025328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||| ||||||||||||||||| ||||||||||||    
5058989 taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg 5058937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 21391371 - 21391319
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||| |||||||||||||||| ||||||||| |||    
21391371 taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctg 21391319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41739119 - 41739068
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||   |||||||||||||||||||||    
41739119 gctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg 41739068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 18927890 - 18927945
Alignment:
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||| ||||||||||||||||||| || ||||||||||| || |||||||||||||    
18927890 ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt 18927945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 19198836 - 19198781
Alignment:
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||| |||||||||||||||||||||| ||||||||||| ||||| ||||| ||||    
19198836 ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacccattt 19198781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 24510051 - 24510110
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| | ||||||||| || |||||||| ||||    
24510051 gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt 24510110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33067349 - 33067400
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||| |||||||||| |||||||||||||| ||||    
33067349 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc 33067400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 45638893 - 45638846
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||    
45638893 gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 45638846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4360625 - 4360571
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||  |||||||| |||||    
4360625 gctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg 4360571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7867356 - 7867302
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||  ||||||||||||||||||    
7867356 gctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg 7867302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12360604 - 12360658
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| |||| ||||||| |||||    
12360604 gctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg 12360658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 15211512 - 15211562
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||| ||||||| ||||||||||||||||||    
15211512 gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 15211562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15211857 - 15211803
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||||||||||||||||||| | ||||||    
15211857 gctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg 15211803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 16060597 - 16060646
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| |||||| |||||||||||||||||||||||||||    
16060597 gctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc 16060646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 16083048 - 16083098
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||| ||||||||| |||||||| |||||||||    
16083048 gctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc 16083098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 93
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||| ||||||||||||||||||||| |||||||||| ||||||||    
16083394 aaatatggttttagtccctgcaaatatacctcgttttgattttagtc 16083348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||| |||||| ||||||||||||||| |||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 97
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
59 agtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||| ||||||||||||||||||||||    
18302070 agtccctgcaaatatgtctcgttttggttttagtccctg 18302108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20948756 - 20948810
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| ||||||| ||||||||||||||    
20948756 gctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg 20948810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25658015 - 25658069
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||| ||||||||| ||||||||||||||| ||||||    
25658015 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg 25658069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| |||||||||||||| ||||||| ||| ||||||||||||| ||||||    
26062255 taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt 26062201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31061150 - 31061096
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||  ||||||||||||||||||||||    
31061150 gctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg 31061096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 33067732 - 33067682
Alignment:
40 taagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||||  |||||||||| |||||||||| |||||||||||||||    
33067732 taagctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta 33067682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||| ||||| |||||||||||||    
34382948 gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc 34382997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40718473 - 40718419
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| | |||||| ||||||||||||    
40718473 gctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg 40718419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42482980 - 42483030
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||    
42482980 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 42483030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||| |||||| |||| ||||||||||||||||||| ||||||||||    
48730615 ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc 48730565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 50428874 - 50428928
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||| ||||||||| ||||| ||||||    
50428874 gctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg 50428928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| |||||| ||| |||||||||| ||||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc 7350684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||| |||||||||||||||||||||| ||||| ||||| || |||||||    
8364867 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac 8364814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 10887352 - 10887401
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
10887352 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 10887401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 16026586 - 16026627
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| |||||||||||||| ||||||||||||||||||||||    
16026586 ttttggtccctgcaaatatccctcgttttggttttagtccct 16026627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #201
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16060714 - 16060763
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
16060714 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16060763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #202
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 24977898 - 24977947
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
24977898 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24977947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #203
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 37625029 - 37624976
Alignment:
40 taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||||| |||||||||||||| |||||||  ||||||||||| |||||    
37625029 taagctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc 37624976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 49073692 - 49073745
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |||| |||||||||| ||||||||||||||| |||||    
49073692 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct 49073745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 19198950 - 19198894
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| ||||||  || ||||||||||||||| ||||| ||||||||||||    
19198950 aagctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg 19198894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 25658282 - 25658246
Alignment:
61 tccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||||||||||| ||||||||||||    
25658282 tccctgcaaatatgcctcgttttgattttagtccctg 25658246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 33380256 - 33380204
Alignment:
43 gctaaaatacggttttagtccc-tgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||| ||| | ||||||||||||||||||||||||||||    
33380256 gctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc 33380204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #208
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4789417 - 4789476
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||  | ||||||||||| || |||||||| ||||    
4789417 gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt 4789476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #209
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 7350663 - 7350620
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| |||||||||||||||||||||||||||||| ||| ||||    
7350663 ttttggtccctgcaaatatgcctcgttttggttttggtctctgg 7350620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 10887306 - 10887349
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
10887306 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 10887349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 12322718 - 12322773
Alignment:
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||| ||||||||| |||||||||||| | ||||||||| |||| |||||||||||    
12322718 ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaattt 12322773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 12360712 - 12360771
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| | ||||||||| || | |||||| ||||    
12360712 gtccctgaccccacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt 12360771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 17129975 - 17129916
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| |||||||| || || |||||||| ||||    
17129975 gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt 17129916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 46183757 - 46183800
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
46183757 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 46183800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 49923822 - 49923763
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||| | |||| ||| |||||||||||| |||||||| ||||||||||||    
49923822 actaggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg 49923763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1159838 - 1159784
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | ||||||| | ||||||| ||||| |||||||||||||||||||    
1159838 gctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg 1159784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4565335 - 4565281
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||| | ||||||||||||||| ||||||||  ||||||||||||    
4565335 gctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg 4565281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8364915 - 8364861
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||| ||||||||| |||||||||||||| |||||||    
8364915 gctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg 8364861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 15466250 - 15466300
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||||||||| ||  ||||||| ||||    
15466250 cccacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt 15466300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 18928143 - 18928089
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||||| |||||| ||| ||||||||||| ||| |||| |||||||||||    
18928143 aagctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc 18928089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21383427 - 21383373
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||| ||| |||||||||||||| ||||| ||||||||||||    
21383427 gctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg 21383373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 22674204 - 22674254
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||  |||| |||||||||| ||||||||||||||||||    
22674204 gctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc 22674254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24978121 - 24978067
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||  ||||||||||||||||||||||||||| ||||    
24978121 gctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg 24978067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #224
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 26142421 - 26142471
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||  |||||| || | ||||||||||||||||||||||||||||    
26142421 gctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtc 26142471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #225
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 26142672 - 26142630
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttg 84  Q
    |||||||||| ||||||| |||||||||||||||||| |||||    
26142672 agctaaaatatggttttaatccctgcaaatatgcctcattttg 26142630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #226
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
26324874 ttttggtccctgcaaatatgtctcgttttggttttcgtccctg 26324832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    |||| ||||||||||||||||||||||||||||||    
28507188 ttttggtccctgcaaatatgcctcgttttggtttt 28507222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28507457 - 28507403
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||| ||| |||| |||||||||||||    
28507457 gctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg 28507403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 34002693 - 34002743
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||| |||||||| ||||||||||| || ||||| |||||||    
34002693 cccacttttgtgacgatttgcacacgtggcacatgatgactgagccaattt 34002743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39747475 - 39747528
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||| | ||||||||||||||||||||||    
39747475 gctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg 39747528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 41738914 - 41738964
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||| ||||    
41738914 cccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt 41738964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 42483213 - 42483167
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||||    
42483213 cccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca 42483167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 42483270 - 42483224
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| |||||| |||||||||||||||| | |||||||||||    
42483270 gctaaaatatggttttggtccctgcaaatatgctttgttttggtttt 42483224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 46868239 - 46868277
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||||||||||||||| || ||||||||||||||    
46868239 ttttagtccctgcaaatatgcttcattttggttttagtc 46868277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||| |||||||||||||||||||||| ||||| |||||    
49073944 gtccctgaccccacttttgtgatgatttgcacacgtgtcacat 49073902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #236
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 726
Target Start/End: Original strand, 7451925 - 7451962
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaa 726  Q
    ||||||||||||| |||||||||||||||||| |||||    
7451925 agacgaacagagaccggtgaaactgagaatacaaacaa 7451962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #237
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 10552020 - 10551991
Alignment:
296 cagggactaaaaccatattttagccaataa 325  Q
    ||||||||||||||||||||||||||||||    
10552020 cagggactaaaaccatattttagccaataa 10551991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #238
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 15058765 - 15058716
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||||  |||||  |||||||||||||| |||||||||||||||||    
15058765 gctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt 15058716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #239
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 16026819 - 16026774
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
16026819 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 16026774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #240
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 24510307 - 24510258
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| |||||||||||||||  ||||||| ||||||||    
24510307 gctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt 24510258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 24649374 - 24649345
Alignment:
296 cagggactaaaaccatattttagccaataa 325  Q
    ||||||||||||||||||||||||||||||    
24649374 cagggactaaaaccatattttagccaataa 24649345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| |||| |||||||||||||| ||||  ||||||||||||    
29579322 ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg 29579375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #243
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 188
Target Start/End: Original strand, 32420208 - 32420245
Alignment:
151 ccctgaacccacttttgtgatgatttgcatacgtggca 188  Q
    |||||| |||||||||||||||||||||| ||||||||    
32420208 ccctgaccccacttttgtgatgatttgcacacgtggca 32420245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 33000550 - 33000505
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
33000550 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 33000505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 33045475 - 33045524
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || | |||||| ||||    
33045475 ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 33045524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 36912854 - 36912895
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttg 84  Q
    ||||||||| |||||| ||||||||||||||| |||||||||    
36912854 gctaaaatatggttttggtccctgcaaatatgtctcgttttg 36912895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Original strand, 37646760 - 37646797
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||| |||||||| ||||||||||||    
37646760 gtccctgcaaatatgcttcgttttgattttagtccctg 37646797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #248
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 38150967 - 38151012
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
38150967 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 38151012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #249
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 765
Target Start/End: Original strand, 38544380 - 38544457
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacc 765  Q
    ||||||||| ||||| ||||  | |||||||| ||| ||||| ||||| |||||| |||||||||| |||||||||||    
38544380 agacgaacaaagatccgtgattcagagaatacaaactaaagacgtcgtatatatgtggaacacccgaaaataaacacc 38544457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #250
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| |||||| ||||||||||||||| ||||||||| |||| ||||    
39025112 taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc 39025161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 39747592 - 39747641
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
39747592 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 39747641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 44157923 - 44157874
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || | |||||| ||||    
44157923 ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 44157874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||| ||||||||||| || |||||||| ||||    
46183812 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 46183857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 99; Significance: 2e-48; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 288 - 103
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||          ||||||||||||||||||||                 
288 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 189  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
188 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 2e-48; HSPs: 258)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 50714564 - 50714379
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||          ||||||||||||||||||||                 
50714564 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 50714465  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50714464 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 50714379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 6827873 - 6827687
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
6827873 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 6827774  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6827773 tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 6827687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 38054549 - 38054731
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||             |||    
38054549 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 38054648  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
38054649 aatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtagtttttggtccctgc 38054731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51709026 - 51708841
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||          ||||||||||||||||||||                 
51709026 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 51708927  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
51708926 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 51708841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32208543 - 32208727
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||         ||||||||||||||| ||||             |    
32208543 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaattgtttttggtccctacaaaattttttgtttttg 32208642  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| || ||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||    
32208643 aaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 32208727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 35415300 - 35415486
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||           ||||||||||||||||||||                
35415300 gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 35415399  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
35415400 tgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 35415486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13479273 - 13479456
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||| |||||  |         |||||||||||||||| |||             |    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactcccta-taaaaaaaaattgtttttggtccctgtaaaattttttgtttttg 13479371  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
13479372 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 13479456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41620255 - 41620069
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||           ||||||||||||||||||||                
41620255 gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 41620156  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||    
41620155 tgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttggagtttttgatccctgc 41620069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 43 - 225
Target Start/End: Complemental strand, 16712690 - 16712509
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |         |||||||||||| |||||||             |    
16712690 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtctctgcaaaattttttgtttttg 16712592  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
     |||||||||||||  ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||    
16712591 taaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttggtccct 16712509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 43 - 225
Target Start/End: Complemental strand, 55482467 - 55482286
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||| ||||||||||||||||||||||||||||||| |         ||||||||||| |||| |||             |    
55482467 gctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggttcctgtaaaattttttgtttttg 55482369  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
55482368 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttggtccct 55482286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 4279233 - 4279148
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4279233 gaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 4279148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 34355065 - 34355150
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34355065 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 34355150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 36702001 - 36702185
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||           || |||||| |||||||||||                 
36702001 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgtttttgtttttagtccctgcaaaattttttgttttt 36702100  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
36702101 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtagtttttggtccctg 36702185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 52017869 - 52017687
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||  |||||| |||||||||||                
52017869 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaattttttgtttt 52017770  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52017769 tgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 52017687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 47 - 225
Target Start/End: Complemental strand, 27008401 - 27008223
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaa 146  Q
    ||||| |||||||||| ||||||||||||||||||||||||||||||||||           ||||||||||||| ||||||             |||||    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttgaaaa 27008302  T
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    ||||| |||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
27008301 tagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct 27008223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 45 - 223
Target Start/End: Complemental strand, 51545966 - 51545788
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||              ||    
51545966 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttcgtttttaaa 51545867  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||    
51545866 aatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtcc 51545788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29463912 - 29463727
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||            ||||||||||||||||||||                 
29463912 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 29463813  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
29463812 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagttttttgtccctgc 29463727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 142 - 224
Target Start/End: Complemental strand, 34362044 - 34361962
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34362044 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 34361962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 41346217 - 41346036
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttg-tttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||| ||||||||||||||| ||||          |  |||||||||||||||||                 
41346217 gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaatcatttttggtccctgcaaaattttttgttttt 41346118  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41346117 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 41346036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41921083 - 41920898
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||| |||||||||||||  ||||||||||||||||||  |||         || ||||||||||||||||||                 
41921083 gctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt 41920984  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
41920983 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 41920898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 18205157 - 18205341
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||             |    
18205157 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 18205256  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||  ||| ||||||||||||||||||||||||||||  |||||||| |||||| ||||||||||||||||||||||||    
18205257 aaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaactaattttgtagtttttggtccctgc 18205341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 27427944 - 27428029
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
27427944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtagtttttggtccctgc 27428029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9446322 - 9446138
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | |||||||||||| ||||||| |||||||||||||| |||||||           ||||||||||||||||||||             |    
9446322 gctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 9446223  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||  ||||||||||  ||||||||||||||||||||||||||||    
9446222 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataacaaaaccaattttgtagtttttggtccctgc 9446138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 13064160 - 13064335
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |         |||||||||||||| |||||             |    
13064160 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg-taaaaaaaaattgtttttggtccccgcaaaattttttgtttttg 13064258  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
     ||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||||||||| ||||||    
13064259 taaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgtaatttttg 13064335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 24474861 - 24474776
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||    
24474861 gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtagttttgggtccctgc 24474776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35763954 - 35763768
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||         ||  ||||||||||||||||||                
35763954 gctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgtttt 35763855  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||| | |||| |||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||| |||||||    
35763854 tgaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaattttctagtttttgatccctgc 35763768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 9289267 - 9289449
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||           ||||||||||||||||||||                
9289267 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 9289366  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||| | |||| |||||||||||||||||||    |||||||||||||||||||||||| |||||||||||||||||    
9289367 tgaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaattttctagtttttggtccctgc 9289449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 18136014 - 18135931
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
18136014 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct 18135931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 49123222 - 49123139
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
49123222 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct 49123139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 22584606 - 22584424
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||  |||||||||| |||||||||||| |||||||||||||||||||||           ||||||||||||||||||||             |    
22584606 gctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttg 22584509  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||    
22584508 aaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaattttgtagtttttgatccctgc 22584424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32365095 - 32365280
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |          ||||||||||||||||||||                 
32365095 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 32365194  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||||||  |||| ||||||||||||||||||||||||||||| ||  ||||||| |||||||||||||||||||||||    
32365195 taaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtagtttttggtccctgc 32365280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 46087860 - 46087943
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
46087860 gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaattttgtagtttttggtccctgc 46087943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 123793 - 123708
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
123793 gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtagttttcggtccctgc 123708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 55072492 - 55072572
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
55072492 aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttatagtttttggtcc 55072572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 5063105 - 5063188
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    ||||||||||| ||| |||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||    
5063105 gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtagtttttggtccct 5063188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45505893 - 45505706
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||    |         ||||||||||||||||||||               
45505893 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaattttttttttttgtttttggtccctgcaaatttttttgttt 45505794  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
       ||| |||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||||||||||    
45505793 tttaaattagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttggtccctgc 45505706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 161 - 227
Target Start/End: Complemental strand, 50822178 - 50822112
Alignment:
161 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
50822178 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 50822112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45593229 - 45593411
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  |||||||||||| ||||||||||||||||||| ||||||||||| |         | ||||||||||||||||||                  
45593229 gctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg-taaaaaaaaatagtttttggtccctgcaaaaatttttgtttttt 45593327  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
45593328 aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 45593411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 210
Target Start/End: Complemental strand, 53717173 - 53717004
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||             ||||||||| ||||||||||                
53717173 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaattttttgtttt 53717074  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 210  Q
      |||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||    
53717073 ttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 53717004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 142 - 224
Target Start/End: Original strand, 3178784 - 3178866
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    ||||||||||||||| ||||||||| | ||||||||||||| || ||||||||||||||||||||||||||||||||| ||||    
3178784 gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaattttgtagtttttgatccc 3178866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 18830946 - 18831031
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||  | |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||    
18830946 gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtagtttttgatccctgc 18831031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 2180471 - 2180387
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| |||||||||||||||||||||||  |||| || |||||||| |||||||||||||||||||||||    
2180471 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtagtttttggtccctgc 2180387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 143 - 222
Target Start/End: Complemental strand, 22099809 - 22099730
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 222  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||    
22099809 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtc 22099730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 35415632 - 35415576
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
35415632 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 35415576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 35763648 - 35763704
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
35763648 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 35763704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 41345854 - 41345910
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41345854 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41345910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13064464 - 13064410
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
13064464 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 13064410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 15555560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41619902 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41619956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 52017506 - 52017560
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
52017506 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 52017560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 52441764 - 52441942
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||           ||||||||||||||||||||                  
52441764 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 52441861  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||  ||| |||| ||||||||||||||||||||||| ||| | || |||||||| |||||||||||||||||||    
52441862 aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtagtttttggtcc 52441942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 52429829 - 52429898
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| |||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||| |||||    
52429829 cccatttttgtgatgatttgcatacgtggcacattataacttaataaattttgtagtttttggttcctgc 52429898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 123535 - 123591
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||    
123535 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 123591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 50714241 - 50714297
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||    
50714241 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 50714297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 13479615 - 13479556
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
13479615 actaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13479556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 22099544 - 22099595
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
22099544 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 22099595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 33 - 96
Target Start/End: Complemental strand, 29420546 - 29420483
Alignment:
33 tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||| |||||| ||||||||||||||| |||||||||||||||||||||    
29420546 tataaactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct 29420483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 98
Target Start/End: Complemental strand, 46088059 - 46088004
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||    
46088059 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg 46088004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2034854 - 2034800
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
2034854 gctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg 2034800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2180221 - 2180275
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||    
2180221 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 2180275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 11285558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13530712 - 13530658
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
13530712 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 13530658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23245232 - 23245286
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
23245232 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23245286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24774046 - 24774100
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24774046 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24774100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27008085 - 27008139
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
27008085 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 27008139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29499183 - 29499237
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
29499183 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30046791 - 30046737
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
30046791 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 30046737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30061132 - 30061078
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
30061132 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 30061078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32365482 - 32365428
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
32365482 gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 32365428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35464381 - 35464327
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
35464381 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35464327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36054149 - 36054095
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||    
36054149 gctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg 36054095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 42848390 - 42848336
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
42848390 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 42848336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43231388 - 43231334
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
43231388 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 43231334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45505601 - 45505655
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
45505601 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 45505655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46115415 - 46115469
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
46115415 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 46115469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46128549 - 46128603
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
46128549 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 46128603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 55072390 - 55072444
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
55072390 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 55072444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| | |||||||||||||||||||||||||||||||||||||||||||    
9445951 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 9446004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 23778965 - 23779014
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||    
23778965 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 23779014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 24474962 - 24474909
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||    
24474962 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct 24474909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 28809179 - 28809126
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
28809179 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct 28809126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 43368467 - 43368651
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga 143  Q
    |||||||| ||||||||||||||||||||||  |||||||||||||||||||||           ||||||||||||||||||||              |    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttta 43368566  T
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttggtccctgc 227  Q
    ||||||||  ||| |||| |||| |||||||||||||||||||||||| || | |||| ||| ||||||||||||||||| ||||    
43368567 aaatagtcgttgaccccatttttatgatgatttgcatacgtggcacataatgaatgaacccatttttgtagtttttggtctctgc 43368651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 6827547 - 6827603
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||    
6827547 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggt 6827603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 9289634 - 9289582
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
9289634 aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 9289582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
29499543 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 51708694 - 51708750
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||    
51708694 gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggt 51708750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
55072709 taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 55072657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 4211562 - 4211617
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||    
4211562 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg 4211617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 5052583 - 5052532
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||||||    
5052583 gctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 5052532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 6353638 - 6353583
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||| |||||| |||||||||||||| |||||||||||||||||||||||    
6353638 agctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg 6353583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29380909 - 29380858
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
29380909 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 29380858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 34361804 - 34361855
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
34361804 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 34361855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 36702363 - 36702308
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||    
36702363 agctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg 36702308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5827972 - 5827918
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
5827972 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 5827918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5882553 - 5882606
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
5882553 gctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg 5882606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8191390 - 8191336
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||    
8191390 gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg 8191336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8760780 - 8760726
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||    
8760780 gctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg 8760726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12791973 - 12791919
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
12791973 gctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg 12791919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13073760 - 13073814
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13073760 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13073814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13631229 - 13631283
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13631229 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13631283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13631598 - 13631544
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13631598 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 13631544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14487803 - 14487857
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||| |||||||    
14487803 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 14487857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14791805 - 14791751
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
14791805 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14791751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22099911 - 22099857
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||| |||    
22099911 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg 22099857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25423925 - 25423979
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
25423925 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25423979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25424311 - 25424257
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
25424311 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25424257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26412583 - 26412529
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
26412583 gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 26412529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35464019 - 35464073
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35464019 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35464073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43231089 - 43231143
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
43231089 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 43231143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46115778 - 46115724
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||| | ||||||||||||||||||||||    
46115778 gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46115724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46128912 - 46128858
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||| | ||||||||||||||||||||||    
46128912 gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46128858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46292393 - 46292447
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||| |||||||    
46292393 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 46292447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 46292650 - 46292600
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||    
46292650 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 46292600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 51545630 - 51545680
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||||||    
51545630 gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 51545680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52430099 - 52430045
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| |||||||| |||||||||||||    
52430099 gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg 52430045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52442091 - 52442037
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||    
52442091 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg 52442037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 53915684 - 53915738
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
53915684 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 53915738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 53916058 - 53915992
Alignment:
31 tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| || ||||||||| |||||| ||||||||||||||| ||||||||||||||||| ||||    
53916058 tatataaaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 53915992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 54903474 - 54903420
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||    
54903474 gctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg 54903420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 18205468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 23245601 - 23245540
Alignment:
36 aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
23245601 aaactaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 23245540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 93
Target Start/End: Original strand, 28448828 - 28448885
Alignment:
36 aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||| ||||||||| ||||||||||| | |||||||||||||||||||||||||||    
28448828 aaactaggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc 28448885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 32208900 - 32208847
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||| |||||||||||||||||||||||| |||||||||||    
32208900 gctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct 32208847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 11285605 - 11285689
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| |||||||||||||||||||| ||||| |  || |||| | | |||||||||||||||||||||||    
11285605 aaaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtagtttttggtccctgc 11285689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 15555639 - 15555587
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||||  ||||||||||||||||||||| ||||||||||||||||||    
15555639 aagctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc 15555587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||| ||||||||||||    
30060772 taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg 30060824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 97
Target Start/End: Original strand, 2322093 - 2322148
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||| |||||| |||||| |||||||||||||||||||||||||| ||||    
2322093 agctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg 2322148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 4279334 - 4279283
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||||||||||||||||||| |||||||||||||||||||    
4279334 gctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc 4279283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 11692870 - 11692929
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| ||||||||||||||||||| |||||||||||||| || |||||||| ||||    
11692870 gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacccattt 11692929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 12152497 - 12152438
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||| |||||| ||||||||||||||| |||||||||||||| |||||||    
12152497 actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg 12152438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13074124 - 13074073
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||| ||||||||||||||||||||    
13074124 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc 13074073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 29380669 - 29380724
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||  ||||||||||||||||||||| |||||||||||||| ||||||||    
29380669 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg 29380724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 29420436 - 29420365
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||| || | ||||||||||||||||| |||||||||||||||| || | |||||| |||||||||    
29420436 gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag 29420365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 53716922 - 53716973
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| || ||||||||||||||||    
53716922 gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 53716973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 2034552 - 2034594
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||||||||||||||||||||||    
2034552 ttttggtccctgcaaatatgcctcgttttggttttagtccctg 2034594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4279023 - 4279077
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||| ||||||||||||  ||||||||||||||||||||||    
4279023 gctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg 4279077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5827656 - 5827710
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
5827656 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 5827710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8760605 - 8760659
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||| |||||||||||||| ||||||||||||||||||||||    
8760605 gctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg 8760659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11693120 - 11693066
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||| ||||||||||||    
11693120 gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 11693066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13764614 - 13764668
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||| ||||||||    
13764614 gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg 13764668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14488186 - 14488132
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
14488186 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 14488132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19321858 - 19321804
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||  |||||||||||||||||||||    
19321858 gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 19321804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||| |||||| ||||||||||||||| |||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 19903603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20291987 - 20292037
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||    
20291987 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 20292037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 22584288 - 22584338
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||| |||||||||| ||||||||||||||||||    
22584288 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 22584338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23779224 - 23779170
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||| ||| ||||||||||||||||||    
23779224 gctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg 23779170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26412191 - 26412245
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
26412191 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 26412245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27427873 - 27427926
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||    
27427873 gctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg 27427926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28809012 - 28809066
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| ||||||||||  |||||||||||||||||||||    
28809012 gctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg 28809066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31560332 - 31560386
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||||| |||||||||||||||||||||    
31560332 gctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg 31560386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31560694 - 31560640
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
31560694 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 31560640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31812212 - 31812158
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||||||||||| ||||||||||||||||||||||    
31812212 gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 31812158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34355282 - 34355228
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||  ||||||| ||||||||||||||||||||||    
34355282 gctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg 34355228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35119293 - 35119347
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||  ||||||||||||||||||||    
35119293 gctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg 35119347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||| ||||||||| ||||||||||||||||||||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 36050343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||| |||||||||| ||||||||||||    
37557194 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg 37557140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41324889 - 41324835
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  || ||||||||||||||||||||||||||||||||||    
41324889 gctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg 41324835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42848028 - 42848082
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||||||||||| ||||||||||||||||||||||    
42848028 gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 42848082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| | ||||||||||||||||||||||||||||||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg 44925790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 45474595 - 45474545
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||||| ||| |||||||||||||    
45474595 gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc 45474545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45593585 - 45593531
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||| ||||    
45593585 gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg 45593531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 766
Target Start/End: Complemental strand, 48098723 - 48098645
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacaccc 766  Q
    |||||||| ||||||||||||||||| ||||| ||||||||| |  || |||| |||||||||||| ||||||||||||    
48098723 agacgaacggagatcggtgaaactgaaaatacaaacaaaagacgcagtatataggcggaacacccgaaaataaacaccc 48098645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 53308067 - 53308013
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| | ||||||||||||||||||||    
53308067 gctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg 53308013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 123893 - 123840
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagt-ccctggt 99  Q
    ||||| |||||||||||||||||||||||||| ||||||||||||| |||||||    
123893 aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggt 123840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||| |||||||||||||||||||||| ||||||||||| || |||||||    
7642544 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 7642491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| ||||||| |||||||||||||||||||||||||| ||||||    
16712331 ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc 16712380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||| ||||||| || |||||||||||||||||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg 18831123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||||||||||||||||||  | |||||||||||||||||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg 30564888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcg-ttttggttttagtccct 96  Q
    ||||||| |||||| |||||||||||||||||||| |||||||||||||||||    
5202929 taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct 5202981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| ||||||||||||||||||| ||||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 14791550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||||||||||||||||||||||| ||||||| |||||    
20144423 taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg 20144475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 25358460 - 25358396
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||| |||||||||||||||||||| | ||||||||||| || |||||||  |||||||||    
25358460 gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag 25358396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||    
54208822 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 54208774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 2180571 - 2180520
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||||  ||||||||||||||||||||| | |||||||||||||||||    
2180571 gctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc 2180520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 5797711 - 5797652
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
5797711 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5797652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 8904887 - 8904934
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||||  ||||| |||||||||||||||||||||||||||||||    
8904887 gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 13530488 - 13530547
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
13530488 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 13530547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 24474601 - 24474651
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||| ||||||||||| ||||||||||||||||||    
24474601 gctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc 24474651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 25424203 - 25424144
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
25424203 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 25424144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 29463611 - 29463658
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| ||||||| | ||||||||||||||||||||||||||||    
29463611 gctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta 29463658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| |||||||||||||||||||||||||||||| ||||||||    
36050359 ttttggtccctgcaaatatgcctcgttttggttttggtccctgg 36050402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 37556837 - 37556896
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||| |||||||| || ||||||||| ||||| |||||||||||||||||    
37556837 actaggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg 37556896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| |||||| |||| |||||||||| |||||||||||||||||||||    
47022743 taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct 47022794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| ||| |||||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 47136119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 58 - 97
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
58 tagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||||||||||||| ||||||||||||||||||    
54208477 tagtccctgcaaatatgcctcattttggttttagtccctg 54208516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2322431 - 2322377
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||| ||||    
2322431 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg 2322377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||| |||||||||||||||||||||||| |||||||||    
5827764 gtccctgaccccacttttgtgatgatttgcatatgtggcacat 5827806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12152155 - 12152209
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||  |||||||||||||    
12152155 gctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg 12152209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13530380 - 13530434
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||| ||||||||||||    
13530380 gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 13530434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18136112 - 18136058
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |  |||| ||||| |||||||||||||||||||||||||||||||    
18136112 gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg 18136058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19321571 - 19321625
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||| ||| ||||||||||||||||||||||||||    
19321571 gctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg 19321625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25358539 - 25358485
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||| ||||||| ||||||||||||||||||||||    
25358539 gctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg 25358485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26314331 - 26314277
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||| ||||||| ||||||||||||||||||||||    
26314331 gctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg 26314277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31182503 - 31182449
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| | |||||||||||| ||||||||||||| ||||||||    
31182503 gctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg 31182449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31811926 - 31811980
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||||  |||||||||||||||||||||    
31811926 gctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg 31811980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 766
Target Start/End: Complemental strand, 42719573 - 42719495
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacaccc 766  Q
    ||||||| ||||| |||||||||||||||||| ||||||||| | ||| |||| |||||| ||| | ||||||||||||    
42719573 agacgaatagagaccggtgaaactgagaatacaaacaaaagacgccgtatataagcggaaaacctgaaaataaacaccc 42719495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42823777 - 42823831
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| ||||||||||||||||| ||||    
42823777 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg 42823831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 44925486 - 44925536
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||    
44925486 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 44925536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47023104 - 47023050
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||||  |||||||||||||||||||||    
47023104 gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg 47023050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 49123320 - 49123266
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |  |||| ||||| |||||||||||||||||||||||||||||||    
49123320 gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg 49123266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51738138 - 51738192
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| ||||||||||||||| ||||||    
51738138 gctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg 51738192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51738410 - 51738356
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||||||||||||||| |||| |||||||    
51738410 gctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg 51738356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||||||| ||||||||||||| ||||    
51763201 gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg 51763147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 11692763 - 11692816
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||  |||||| ||||||||||||||||| ||||||| |||||||||||    
11692763 gctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct 11692816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 24774308 - 24774259
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
24774308 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24774259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 31370805 - 31370854
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||  |||| ||||||||||||||||||||||||    
31370805 gctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt 31370854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||| |||||||||| | |||||||||||||||||||    
35420393 ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg 35420446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| |||| |||||||||| |||| |||||||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg 35420648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 47135897 - 47135942
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||    
47135897 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacca 47135942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 47274229 - 47274180
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||||  |||||||| |||||||||||| |||||||||||||||||    
47274229 gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||    
51738362 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac 51738309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  ||||||||||||||| ||||| || |||||||||||||||||||    
51830891 ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg 51830944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #213
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 54208706 - 54208657
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
54208706 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 54208657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #214
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||| ||| ||||||||||| ||||||||||||||||||||||    
5797484 taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg 5797536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #215
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||||| |||||||| ||||||||||||||| ||||||    
5797817 taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg 5797765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #216
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 25358498 - 25358454
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||||||||| |||||||||||| | |||||||    
25358498 ggttttagtccctgcaaatatgtctcgttttggttgtggtccctg 25358454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #217
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||| |||||||  || ||||||||||||||||||    
50822013 taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg 50822065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4211610 - 4211669
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||||||||||||||||||||| ||||||||||| || | |||||| ||||    
4211610 gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 4211669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Original strand, 5063021 - 5063064
Alignment:
54 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||||||| ||| |||||||||| ||||||||    
5063021 gttttagtccctgcaaatataccttgttttggtttaagtccctg 5063064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #220
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 327
Target Start/End: Original strand, 5063309 - 5063340
Alignment:
296 cagggactaaaaccatattttagccaataaac 327  Q
    ||||||||||||||||||||||||||||||||    
5063309 cagggactaaaaccatattttagccaataaac 5063340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #221
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13764806 - 13764755
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||| |||||||  ||||||||||||||||||    
13764806 gctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc 13764755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #222
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14594207 - 14594258
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||  ||||||||||||||    
14594207 gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 14594258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #223
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 20144730 - 20144683
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| || | ||||||||||||||||||||||||||    
20144730 gctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta 20144683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #224
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 24774354 - 24774311
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
24774354 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 24774311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #225
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 31811996 - 31812039
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
31811996 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 31812039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #226
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 35119610 - 35119559
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||| |||||    
35119610 gctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc 35119559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #227
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 36050395 - 36050454
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||||||||||||||||||||| |||||||| || || |||||||| ||||    
36050395 gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt 36050454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||| |||||||||||||||||||||| ||| ||||| |||||||    
41920771 taaaatatggttttagtccctgcaaatatgactcattttgattttagt 41920818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42824090 - 42824039
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| || |||||| |||||||||    
42824090 gctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc 42824039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 47135851 - 47135894
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
47135851 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 47135894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 51763129 - 51763086
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
51763129 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 51763086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| |||| |||||||||| |||||||||||||||    
52543423 gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #233
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 2034735 - 2034693
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaa 201  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
2034735 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 2034693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
5797747 ttttggtccctgcaaatatgcctcattttggttttggtccctg 5797705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||||||||| |||| |||||||    
11692834 ttttggtccctgcaaatatgcctcgttttgattttggtccctg 11692876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 203
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacc 203  Q
    |||||||| | |||||||||||||||||||| ||||| ||||| || ||||||||    
12791865 gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 12791811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
13530452 ttttggtccctgcaaatatgcctcattttggttttggtccctg 13530494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
20144492 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 20144534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
25424239 ttttggtccctgcaaatatgcctcattttggttttggtccctg 25424197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26313989 - 26314043
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||||   ||||||||||||||||||||    
26313989 gctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg 26314043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 35119381 - 35119431
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| |||||| |||| || |||||||| ||||    
35119381 cccacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt 35119431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 41439909 - 41439951
Alignment:
161 acttttgtgatgatttgcatacgtggcacattataactgaacc 203  Q
    ||||||||||||||||||| ||||||||||| || ||||||||    
41439909 acttttgtgatgatttgcacacgtggcacatgatgactgaacc 41439951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 47023027 - 47022989
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||||||||||||| |||||||||| ||||||||    
47023027 gtccctgcaaatatgcctcattttggttttggtccctgg 47022989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||| |||| |||||||||| ||||||||||||||||| ||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg 47532617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51762871 - 51762925
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||| || ||| |||||||||||| || ||||||||||||||||||    
51762871 gctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg 51762925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 54208747 - 54208709
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||||||||||||| |||||||||| ||||||||    
54208747 gtccctgcaaatatgcctcattttggttttggtccctgg 54208709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 7639895 - 7639944
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||| |||||| |||||| |||||||| || ||||||||||||    
7639895 aagctaaaatatggttttggtccctacaaatatgtcttgttttggtttta 7639944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 8191288 - 8191216
Alignment:
143 aaaatagtccctgaacccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||| |||||| |  ||||||||||||||||||||| ||||  | |||||||  |||||||||    
8191288 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag 8191216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 8905233 - 8905180
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||| ||||||||||| ||||| ||||| |||||    
8905233 gctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct 8905180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||  ||| ||||||||||||||||| ||||||||||| || |||||||    
14488078 gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac 14488025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
14594494 ttttggtccctgcaaatatgtctcgttttggttttggtccct 14594453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #252
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| ||||||||||| || |||||||| ||||||||||||||||||    
18135793 taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc 18135841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 227
Target Start/End: Original strand, 41316068 - 41316097
Alignment:
198 tgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||||    
41316068 tgaaccaattttgtagtttttggtccctgc 41316097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46115660 - 46115611
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
46115660 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46115611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46128794 - 46128745
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
46128794 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46128745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 47022986 - 47022937
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
47022986 ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 47022937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #257
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| ||||||||||| || |||||||| ||||||||||||||||||    
49123000 taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc 49123048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #258
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
54903403 ttttggtccctgcaaatatgtctcgttttggttttggtccct 54903362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 2e-48; HSPs: 281)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 37506868 - 37507053
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||                  
37506868 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaattttttttgttttt 37506967  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37506968 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 37507053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39288897 - 39288713
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||         ||| ||||||||||||||||             |    
39288897 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgattttggtccctgcaaaattttttgtttttg 39288798  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
39288797 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 39288713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39437108 - 39436922
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
39437108 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 39437009  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
39437008 tgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc 39436922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 10976979 - 10977164
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          |||||| |||||||||||||                 
10976979 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccctgcaaaattttttgttttt 10977078  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
10977079 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtagtttttggtccctgc 10977164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 28427607 - 28427422
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                 
28427607 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 28427508  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28427507 gaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttggtccctgc 28427422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 22155930 - 22156116
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||           ||||||||||||||||||||                
22155930 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 22156029  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22156030 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 22156116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3152110 - 3151925
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||||                 
3152110 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt 3152011  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
3152010 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttttttccctgc 3151925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 225
Target Start/End: Original strand, 8510215 - 8510399
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||           ||||||||||||||||||||                
8510215 gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 8510314  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
     |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8510315 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 8510399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 20757403 - 20757585
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| | ||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||             |||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 20757502  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20757503 aatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 20757585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51834941 - 51834756
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||          ||||||||||||||||||||                 
51834941 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaactttttgttttt 51834842  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||    
51834841 gaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaattttgtagtttttggtccctgc 51834756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 275445 - 275628
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||           ||||||||||||||||||||             |    
275445 gctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgc-aaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 275543  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
275544 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 275628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45320978 - 45320794
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||           ||||||||| ||||||||||             |    
45320978 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttgatccctgcaaaattttttgtttttg 45320879  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
45320878 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc 45320794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 13584105 - 13584190
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13584105 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 13584190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 45 - 227
Target Start/End: Complemental strand, 20907454 - 20907271
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga 143  Q
    ||||||| ||||||| |||||||||||||||||| |||||||||||||| ||| |          ||||||||||||||||||||             ||    
20907454 taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga 20907355  T
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
20907354 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 20907271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 21159816 - 21159634
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||           ||  ||||||||||||||||||                
21159816 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt 21159717  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21159716 tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 21159634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26799889 - 26800075
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
26799889 gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 26799988  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||    
26799989 tgaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttttagtttttgttccctgc 26800075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 40169653 - 40169467
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||         ||  ||||||||||||| ||||                
40169653 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaattttttgtttt 40169554  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||    
40169553 tgaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc 40169467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 29955300 - 29955485
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||| |||||||||||||||||||||||||||||||| ||||||||||||           ||  ||||||||||||||||||                 
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 29955399  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
29955400 gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtagtttttggtccctgc 29955485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 30004454 - 30004639
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||| |||||||||||||||||||||||||||||||| ||||||||||||           ||  ||||||||||||||||||                 
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 30004553  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
30004554 gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtagtttttggtccctgc 30004639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 14633888 - 14633701
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    |||||| || |||||||||||||||||||||| || |||||||||||||||||||||            ||||||||||||||||||||               
14633888 gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 14633789  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      ||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14633788 ttgaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 14633701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 216
Target Start/End: Complemental strand, 20612897 - 20612724
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||| ||||||             |    
20612897 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccttgcaaatttttttgtttttg 20612798  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 216  Q
     |||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
20612797 gaaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtagttt 20612724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 34238599 - 34238784
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||          ||||||||||||||||||||                 
34238599 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 34238698  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
34238699 gaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtagttttttatccctgc 34238784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39072212 - 39072027
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn- 141  Q
    ||||||||| ||||||||| |||||||||||||||||||||| ||||| ||||||           ||||||||||||||||||||                  
39072212 gctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaaaaaaaaaattgtttttggtccctgcaaattttttttgttttt 39072113  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39072112 gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 39072027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 4950266 - 4950181
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4950266 gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 4950181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 67 - 227
Target Start/End: Complemental strand, 10778706 - 10778546
Alignment:
67 caaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtccctgaacccactttt 166  Q
    |||||||||||||||||||||||||||||||||         ||||| ||||||||||||||             ||||||||||||||| || ||||||    
10778706 caaatatgcctcgttttggttttagtccctggtaaaaaaaaattgttattggtccctgcaaaattttttgtttttgaaaatagtccctgaccctactttt 10778607  T
167 gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
10778606 gtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc 10778546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 223
Target Start/End: Complemental strand, 19656802 - 19656721
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19656802 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 19656721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 30130159 - 30130343
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||           ||||||||||||||||||||             |    
30130159 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 30130258  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||  |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
30130259 aaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtagtttttggtccctgc 30130343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 45161116 - 45161294
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| ||||| |||||||||||||||| |||||||||||||||||| |||           ||||||||||||||||||||             |||    
45161116 taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 45161215  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||  ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
45161216 aatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtcc 45161294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 31869955 - 31869771
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| |||||||| |||||||||||||           ||||||||||||||||||||             |    
31869955 gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaactttttgtttttg 31869856  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||  |||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||    
31869855 aaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttatagtttttggtccctgc 31869771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 224
Target Start/End: Complemental strand, 4513619 - 4513438
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||           ||||||||||||||||||||                  
4513619 gctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattgtttttggtccctgcaaaattttttgtttttt 4513520  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc 224  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||    
4513519 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccc 4513438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 18175889 - 18175973
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18175889 aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 18175973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 25710869 - 25710686
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||  ||||||                 
25710869 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtc--tgcaaaattttttattttt 25710772  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||||  |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||    
25710771 gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 25710686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 3830135 - 3830317
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||           ||||||||||||| ||||||             |    
3830135 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg--taaaaaaaattgtttttggtccttgcaaaattttttgtttttg 3830232  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||  |||||||||||||| ||||||||    
3830233 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtagttttttgtccctgc 3830317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7518346 - 7518261
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||  |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
7518346 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtagtttttggtccctgc 7518261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 12673904 - 12673819
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||    
12673904 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagttttttgtccctgc 12673819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16123242 - 16123327
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||    
16123242 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttgatccctgc 16123327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 49670721 - 49670652
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
49670721 cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 49670652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51500684 - 51500500
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                  
51500684 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 51500585  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||| ||| ||||||||| |||||||||||||    
51500584 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtaggttttggtccctgc 51500500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 43 - 208
Target Start/End: Complemental strand, 5345688 - 5345522
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||           || ||||||| ||||||||||                 
5345688 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaatttgtttttgatccctgcaaaattttttattttt 5345589  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
     |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5345588 taaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 5345522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 46186669 - 46186584
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||||||||||    
46186669 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc 46186584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 50261839 - 50261755
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||||  |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||    
50261839 gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaattttgtagtttttggtccctgc 50261755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 15016645 - 15016561
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||||||||||    
15016645 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc 15016561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 9863403 - 9863221
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||            | ||||||||||| ||||||                 
9863403 gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatagtttttggtccttgcaaaattttttgttttt 9863304  T
142 gaaaatagtccctgaacccactttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||||  |||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||    
9863303 gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc 9863221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 210
Target Start/End: Original strand, 29445955 - 29446124
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||                
29445955 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 29446054  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 210  Q
      |||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||    
29446055 ttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 29446124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 45521650 - 45521735
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||    
45521650 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttggtccctgc 45521735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 53701476 - 53701545
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||    
53701476 cccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttggtccctgc 53701545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 15286402 - 15286318
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||||||||||    
15286402 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc 15286318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 22156304 - 22156236
Alignment:
31 tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
22156304 tataaaaattaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 22156236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 51759922 - 51760006
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||| ||| ||||||||| |||||||||||||    
51759922 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtaggttttggtccctgc 51760006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 142 - 204
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||    
47901901 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca 47901963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 4814897 - 4814719
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| |||||||||| |||||||||||||||||||||  |         ||||||||||||||||||||                  
4814897 gctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcccta-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 4814800  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| | || ||||||||||||||||||||||||||||| || |||| ||| |||||||||||||||||||    
4814799 aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtagtttttggtcc 4814719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 151 - 227
Target Start/End: Complemental strand, 30426175 - 30426099
Alignment:
151 ccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||| |||| ||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||| |||||||    
30426175 ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtagtttttgatccctgc 30426099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 30552246 - 30552330
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| || | |||| |||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
30552246 aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 30552330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 51834609 - 51834665
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
51834609 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 51834665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 50196401 - 50196484
Alignment:
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||| || | ||||||||||||||||||||||||||||| || |||||||  ||| |||||||||||||||||||    
50196401 aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtagtttttggtccctgc 50196484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4513264 - 4513318
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
4513264 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 4513318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4950038 - 4950092
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
4950038 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 4950092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37507221 - 37507167
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
37507221 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37507167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 50518753 - 50518842
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    |||||||||||||  ||||||||||||||||| |||||||| |||||| |||| |||||||||||| ||||||||| ||||||||||||||    
50518753 agacgaacagagactggtgaaactgagaatacaaacaaaaggtgtcgtatataggcggaacacccgaaaataaaca-ccctaaaaacaccc 50518842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 3151751 - 3151804
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3151751 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 3151804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 50196354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 13584366 - 13584310
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
13584366 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 13584310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 28942904 - 28942848
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
28942904 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt 28942848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 39436719 - 39436775
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
39436719 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 39436775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 43440614 - 43440678
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| ||||    
43440614 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtctctgc 43440678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3830515 - 3830464
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
3830515 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 3830464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 14633547 - 14633602
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggt 14633602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 160 - 219
Target Start/End: Original strand, 40979479 - 40979538
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    |||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||    
40979479 cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgtaatttttg 40979538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 51550070 - 51550137
Alignment:
30 ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||| || ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
51550070 ttataaaaagtaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 51550137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 41 - 99
Target Start/End: Complemental strand, 3361819 - 3361761
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||    
3361819 aagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt 3361761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15016389 - 15016443
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
15016389 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 15016443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16123140 - 16123194
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
16123140 gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 16123194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22008527 - 22008581
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
22008527 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 22008581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22008889 - 22008835
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
22008889 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22008835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22016045 - 22016099
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
22016045 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 22016099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25615976 - 25616030
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
25615976 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25616030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28552382 - 28552328
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
28552382 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28552328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30268506 - 30268560
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
30268506 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 30268560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31480137 - 31480191
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
31480137 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 31480191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 49323783 - 49323837
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
49323783 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 49323837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 53701662 - 53701608
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
53701662 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 53701608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 54608519 - 54608573
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
54608519 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 54608573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
8940522 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8940470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 9262154 - 9262102
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||    
9262154 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 9262102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 10977340 - 10977284
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| || |||| |||||||||||||||||||||||||||||||||||||||    
10977340 gctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt 10977284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 11463231 - 11463287
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| |||||| || |||||||||||||||||||||||||||||||||||    
11463231 aagctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg 11463287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 20611021 - 20611077
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||    
20611021 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggt 20611077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 28427246 - 28427302
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||    
28427246 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt 28427302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 143 - 219
Target Start/End: Original strand, 30268585 - 30268661
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    |||||||| ||||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |||||||||    
30268585 aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttatagtttttg 30268661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 39288574 - 39288630
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||    
39288574 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt 39288630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 40370588 - 40370536
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||    
40370588 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 40370536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 689 - 775
Target Start/End: Complemental strand, 4171161 - 4171075
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaaca 775  Q
    ||||||||||||| |||||||||||||||||| ||||||||  ||||| |||| |||||||||| | ||||||||| |||||||||||    
4171161 agacgaacagagaccggtgaaactgagaatacaaacaaaaggcgtcgtatataggcggaacacctgaaaataaaca-ccctaaaaaca 4171075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 7957118 - 7957059
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| ||||||||||| || |||||||||||||    
7957118 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 7957059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46751272 - 46751323
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
46751272 gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 46751323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 474045 - 474099
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
474045 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 474099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1721451 - 1721397
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
1721451 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 1721397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4034718 - 4034772
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
4034718 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4034772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9261790 - 9261844
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
9261790 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 9261844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12673645 - 12673699
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||| ||||||||||||||||||||||||||||||    
12673645 gctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg 12673699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12740908 - 12740962
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
12740908 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12740962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12741270 - 12741216
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
12741270 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12741216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15979339 - 15979393
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
15979339 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 15979393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19844580 - 19844526
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
19844580 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 19844526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26089731 - 26089785
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
26089731 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 26089785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26090077 - 26090023
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
26090077 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 26090023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28552022 - 28552076
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
28552022 gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg 28552076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 29955661 - 29955611
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||    
29955661 aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 29955611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 30004816 - 30004766
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||    
30004816 aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 30004766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30106219 - 30106165
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||| |||||||||||||||||||||||    
30106219 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg 30106165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31480499 - 31480445
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| || ||| ||||||||||||||||||||||||||||||||||||||    
31480499 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg 31480445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32119583 - 32119529
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
32119583 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 32119529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43441602 - 43441548
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
43441602 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 43441548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44802283 - 44802337
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||    
44802283 gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg 44802337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45002022 - 45002076
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||    
45002022 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 45002076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45002384 - 45002330
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||    
45002384 gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 45002330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46186770 - 46186716
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||    
46186770 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctg 46186716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47336229 - 47336283
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
47336229 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 47336283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47336580 - 47336526
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
47336580 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47336526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48924239 - 48924185
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||    
48924239 gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg 48924185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 50196656 - 50196602
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||    
50196656 gctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg 50196602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51550445 - 51550391
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
51550445 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 51550391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 54608862 - 54608808
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
54608862 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 54608808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 9603630 - 9603683
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||  ||||||||||||||||||||||||||||||||||||    
9603630 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct 9603683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 25610131 - 25610078
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||| |||||| ||||||||||||||||||||||||| |||||||||    
25610131 aagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc 25610078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 190
Target Start/End: Original strand, 28942526 - 28942674
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||   ||||         || ||||||||||||||||||                 
28942526 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccctgcaaaattttatgttttt 28942625  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcaca 190  Q
     ||||||||| |||| |||||||||||||||||||||||||||||||||    
28942626 taaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca 28942674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  ||||||||||||||||||||||||||||||||||||| ||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg 45006194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 49670802 - 49670745
Alignment:
43 gctaaaatacggttttagtccc-tgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||    
49670802 gctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt 49670745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 51760118 - 51760069
Alignment:
42 agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag 91  Q
    |||||||||| |||| ||||||||||||||||||||||||||||||||||    
51760118 agctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag 51760069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 14772212 - 14772264
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||    
14772212 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc 14772264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 34238914 - 34238858
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||| |||||||||| |||||||||||||||||| ||||    
34238914 gctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt 34238858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35569133 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35569081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 40169345 - 40169401
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||| |||||||||||||| ||||||||| ||||||||||||||    
40169345 gctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt 40169401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3387603 - 3387552
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||| |||||||||||||||||||||||||||||||    
3387603 gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc 3387552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||    
4814541 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 4814588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 7518091 - 7518142
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||| ||||||||||||||||||||||||||| ||||||||||    
7518091 gctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc 7518142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
48 aatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||| ||||||||||||||||||||||  |||||||||||||||||||||||    
8510523 aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt 8510472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| ||||||||||||||||| ||||||||||||||||||||||||||    
9863050 taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct 9863100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 19656542 - 19656593
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||| |||||||||||||||||||| |||||||||    
19656542 gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc 19656593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21159454 - 21159505
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| ||||||||| |||||||||    
21159454 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 21159505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29446205 - 29446154
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| || ||||||||||||||||    
29446205 gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 29446154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 93
Target Start/End: Complemental strand, 29490747 - 29490692
Alignment:
38 actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||| ||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
29490747 actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 29490692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29525106 - 29525157
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||| ||||||||||    
29525106 gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc 29525157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 40277931 - 40277990
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40277931 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40277990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 43440774 - 43440735
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||||||||||||||||||||||||||||||||    
43440774 ttttagtccctgcaaatatgcctcgttttggttttagtcc 43440735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||||||||||||||||||||||||||||| |||||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc 46186461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 47005518 - 47005467
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||| ||||||||||||||||||||    
47005518 gctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc 47005467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 52342582 - 52342531
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||| |||||||||||||||||||||||||||||||    
52342582 gctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc 52342531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||| ||||    
474407 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 474353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4035052 - 4034998
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||| ||||    
4035052 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg 4034998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7957225 - 7957171
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||||||||||||||| |||||||||||||||||||||    
7957225 gctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg 7957171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| |||||||||||| |||||||||||||||||||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg 9596813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9597094 - 9597040
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||||| |||||||||||||||||||||    
9597094 gctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg 9597040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 15286157 - 15286207
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||| ||||||||||||||| |||||||||||||||||    
15286157 gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc 15286207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15979700 - 15979646
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| ||||||||||||||||||||||    
15979700 gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 15979646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21553890 - 21553944
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| ||||||| |||||    
21553890 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg 21553944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 25710515 - 25710565
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
25710515 aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 25710565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28452375 - 28452321
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| ||||||||| |||||||||||||||||||||    
28452375 gctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg 28452321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30552477 - 30552423
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||||||| |||||||||| ||||||||||||||||||||||    
30552477 gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg 30552423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35565509 - 35565563
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||||||||||| |||||||||||||||||||||||    
35565509 gctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg 35565563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40545565 - 40545619
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||| |||||||||||||    
40545565 gctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg 40545619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40979709 - 40979655
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||    
40979709 gctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg 40979655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||| ||||    
43441271 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 43441325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45313862 - 45313808
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||| ||||||||||||    
45313862 gctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg 45313808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47005155 - 47005209
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| |||||||| |||||||||||||    
47005155 gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg 47005209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51759820 - 51759874
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||| |||| |||||||||||| ||||||||||||||||||||||    
51759820 gctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg 51759874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 681 - 776
Target Start/End: Complemental strand, 25648109 - 25648013
Alignment:
681 ccctgttca-gacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacac 776  Q
    ||||||||| ||||||||||||||||||||||| ||||||| ||||||||  |  || ||||  ||||||||||| ||||||||| ||||||||||||    
25648109 ccctgttcaagacgaacagagatcggtgaaactaagaatacaaacaaaaggcgcagtatatagacggaacacccgaaaataaaca-ccctaaaaacac 25648013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 30034353 - 30034304
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||||||    
30034353 ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 30034304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||| | |||||||||||| ||||||||||||||||||||||    
31869596 ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg 31869649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 43440496 - 43440549
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||| |||||||||| |||||||| ||||||||||||    
43440496 gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct 43440549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 144 - 213
Target Start/End: Complemental strand, 45313759 - 45313690
Alignment:
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    ||||||||||||  |||||||||||||||||||| ||| ||||| ||| || |||||||| |||||||||    
45313759 aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag 45313690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
3387268 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 3387320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||| ||||||| |||||||||||||| |||||||||||||||||    
7518444 ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt 7518396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 30426225 - 30426174
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| ||||||||||| |||||||||||||||||||| ||||||||||    
30426225 gctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc 30426174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||| ||||||| ||||||||||||||||||||||    
49324143 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 49324091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4034826 - 4034885
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
4034826 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4034885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 9262045 - 9261986
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
9262045 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9261986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 9603918 - 9603871
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| ||||||||||||||||||| |||||||||||    
9603918 gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 9603871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 30130499 - 30130452
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||| |||||||||| ||||||||||||||| |||||||||||||||    
30130499 aaatatggttttagtcactgcaaatatgcctcattttggttttagtcc 30130452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 52342196 - 52342243
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| ||||||||||||||||||| |||||||||||    
52342196 gctaaaatatggttttggtccctgcaaatatgcctccttttggtttta 52342243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 2486784 - 2486734
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||||||||| || |||||||| ||||    
2486784 cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2486734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||| |||||| |||||||||||||||| ||||||||||||||    
2486900 ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 2486854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7588319 - 7588369
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||  ||||| |||||||||||||||||| |||||||||||||||    
7588319 gctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc 7588369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19844266 - 19844320
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||||||||||||  ||||||||||||    
19844266 gctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg 19844320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 27681681 - 27681627
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||| | ||| ||||||||||||||||||||||||||| ||||||    
27681681 gctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg 27681627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29678025 - 29678079
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| |||  |||||||||||||||||||||||||||||||||    
29678025 gctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg 29678079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30034471 - 30034417
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||| |||||||||| ||||||||||||||||||||||    
30034471 gctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg 30034417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30128285 - 30128339
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||| ||| ||||||||||||||||| ||||    
30128285 gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg 30128339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 30424629 - 30424679
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||||||||||||| || ||||| |||||||||    
30424629 gctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc 30424679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32119221 - 32119275
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||| |||||||| |||||||||||||    
32119221 gctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg 32119275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 692 - 766
Target Start/End: Original strand, 33143619 - 33143693
Alignment:
692 cgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaataaacaccc 766  Q
    |||||| | |||||||||||||||||||| | ||||||  ||| | |||| ||||||||||||||| ||||||||    
33143619 cgaacataaatcggtgaaactgagaatacaaccaaaaggcgtcatatataggcggaacacccgaaaaaaacaccc 33143693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||| ||||||||||||||||||| ||||||||||||||    
36673072 gtccctgaccccacttttgtgatgatttacatacgtggcacat 36673114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40277823 - 40277877
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  |||||| |||||||||||||||| |||||||||||||| ||||||    
40277823 gctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg 40277877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46622128 - 46622074
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| ||||||||||  |||||||||||||||||||||    
46622128 gctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg 46622074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 46901222 - 46901276
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt 217  Q
    |||| |||||||||||||||||| ||||| ||||||||||  |||||||||||||    
46901222 ttttttgatgatttgcatacgtgacacatgataactgaactcattttgtagtttt 46901276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 47114488 - 47114538
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||| ||||||||||||||| ||||||||||||||||||    
47114488 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 47114538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 95
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||| |||||||||| ||| |||||||| |||||||||||||||||||    
47901803 taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc 47901853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47902144 - 47902090
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||| |||||||||| | |||||||||||||||||||    
47902144 gctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg 47902090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 51500399 - 51500449
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||| ||||| ||| ||||||||||||||||||||||||||    
51500399 gctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc 51500449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 275832 - 275783
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| | |||||||||||| |||||||| ||||||||||||||||    
275832 gctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt 275783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| |||||| |||| ||||||||||| ||||||||||||||||||    
8555305 taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc 8555256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9596976 - 9596927
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||| ||||||||||||||||||||||| || |||||||| ||||    
9596976 ccacttttgagatgatttgcatacgtggcacatgatgactgaacccattt 9596927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||||| | ||||||||| |||| ||||||||||||||||||    
14772523 ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg 14772470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| ||||||||||| || |||||||| |||||||||||||||||    
16679678 ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc 16679727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 20405104 - 20405055
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||||||||| ||||| || |||||||| ||||    
20405104 ccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 20405055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 25353200 - 25353241
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttg 84  Q
    |||| |||| ||||||||||||||||||||||||||||||||    
25353200 gctagaatatggttttagtccctgcaaatatgcctcgttttg 25353241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 35177256 - 35177305
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| | |||| ||||||||||||||| |||||||||||||||||    
35177256 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 35177305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35177374 - 35177423
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
35177374 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35177423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35565627 - 35565676
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
35565627 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35565676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 46901105 - 46901154
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||| |||||||||||  ||||||||||||||||    
46901105 gctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt 46901154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||||||||||||||  |||||||| ||||||||||||    
863649 taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg 863597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 732 - 784
Target Start/End: Original strand, 1652583 - 1652635
Alignment:
732 gtcgtttatatgcggaacacccgaaataaacacccctaaaaacacccttgcga 784  Q
    ||||| |||| ||||||||||||||||||||||||  ||| ||||||||||||    
1652583 gtcgtatataggcggaacacccgaaataaacacccacaaagacacccttgcga 1652635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||| |||||||||| ||| ||||||||||||||||||    
1721092 taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg 1721144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 92
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||| |||||| ||||||||||||||| ||| |||||||||||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt 2486629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||  ||||| ||||||||||||||| || |||||||||||||||||||    
4322186 taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg 4322134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||  || |||||||||| |||||||||||||||||||||||    
8940163 taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg 8940215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||  ||||||||||||||||||||| ||||||| ||||    
10778373 taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg 10778425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 25610060 - 25610016
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| ||||||||||||||| |||||||||||||| |||||||    
25610060 ggttttggtccctgcaaatatgtctcgttttggttttggtccctg 25610016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 28418901 - 28418845
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| |||||| |||||||||||||||  | |||||| ||||||||||||    
28418901 aagctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg 28418845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 35533395 - 35533439
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||||||||||||||||| ||||||||||| || |||||||    
35533395 cccacttttgtgatgatttgcacacgtggcacatgatgactgaac 35533439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||| ||||||||||||||| ||| ||||||||||||||||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg 40545784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| ||||||||||| ||||||||| ||||| |||||||||||||    
40723121 taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc 40723169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||  |||||||||||||| ||||||||| ||||||||||||    
45005889 taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg 45005941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 128
Target Start/End: Original strand, 49670477 - 49670560
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa 128  Q
    ||||||| | ||||||||| |||||||||| || |||||||||||| ||||||||         ||||||||||||||||||||    
49670477 taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggtaaaaaaaaattgtttttggtccctgcaaa 49670560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa 201  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || ||||||    
52342473 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa 52342421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 94
Target Start/End: Original strand, 590197 - 590228
Alignment:
63 cctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||||||||||||||||||||||||    
590197 cctgcaaatatgcctcgttttggttttagtcc 590228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 3387338 - 3387381
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
3387338 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 3387381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 8555199 - 8555140
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| ||||| ||||  |  |||||||||||||    
8555199 gtccctgaccccacttttgtgatgatttgcacacgtgtcacacgacgactgaaccaattt 8555140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 92
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||| | ||||||| |||||||||||||||| |||||||||||||    
12673978 taaaatatgattttagttcctgcaaatatgcctcattttggttttagt 12673931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13514576 - 13514525
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| || |||||||||||| |||||||||||||||||||    
13514576 gctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc 13514525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 92
Target Start/End: Complemental strand, 16123490 - 16123452
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||||| ||||||||||||||||||||||||||||    
16123490 ggttttagtcc-tgcaaatatgcctcgttttggttttagt 16123452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18175792 - 18175844
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||  ||||||||| ||||||    
18175792 gctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctg 18175844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 28418659 - 28418702
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaa 201  Q
    |||||||||||||||||||||| ||||||||||| || ||||||    
28418659 cccacttttgtgatgatttgcacacgtggcacatgatgactgaa 28418702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28452148 - 28452199
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||| |||||||||| || ||||||||||||||||    
28452148 gctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc 28452199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 35565581 - 35565624
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||    
35565581 ttttggtccctgcaaatatgcctcattttggttttagtctctgg 35565624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 203
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
152 cctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacc 203  Q
    ||||| |||||||||||||||||||||| | ||||||||| || ||||||||    
36732750 cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 36732801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 38232242 - 38232293
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| ||||||||||||||| ||||||||| |||||||||    
38232242 gctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc 38232293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 39132834 - 39132791
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||| |||||||||||||| ||||||||    
39132834 ttttggtccctgcaaatatgtctcgttttggttttggtccctgg 39132791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 45005959 - 45006002
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
45005959 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 45006002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 52956627 - 52956584
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
52956627 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 52956584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 53113496 - 53113551
Alignment:
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||| |||||||||||||||||||||| || |||||||| || |||||||| ||||    
53113496 ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacctattt 53113551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #241
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
4034790 ttttggtccctgcaaatatgcctcattttggttttggtccctg 4034832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #242
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
7957154 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 7957112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #243
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
9262081 ttttggtccctgcaaatatgcctcattttggttttggtccctg 9262039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #244
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||  ||| ||||||| ||||||||||||||||||||||    
11463480 gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc 11463430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #245
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Complemental strand, 15016412 - 15016382
Alignment:
296 cagggactaaaaccatattttagccaataaa 326  Q
    |||||||||||||||||||||||||||||||    
15016412 cagggactaaaaccatattttagccaataaa 15016382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #246
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20405222 - 20405168
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||| | | ||||| |||||||||||||    
20405222 gctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg 20405168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #247
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20644506 - 20644560
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||| ||| ||||| ||||||||||||    
20644506 gctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg 20644560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #248
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20644875 - 20644821
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| |||||| || ||||||| ||||||||||||    
20644875 gctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg 20644821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #249
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 20757774 - 20757724
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | ||||| |||||| |||||||| |||||||||||||||||    
20757774 gctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc 20757724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25609768 - 25609822
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||  | |||||| ||||||||||||||||||||||||    
25609768 gctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg 25609822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29686545 - 29686599
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| |||| |||||| |||| |||||||||| || |||||||||||||||||||    
29686545 gctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg 29686599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||| |||||| |||| || |||||||||||||||||||||||    
30034109 ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta 30034155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35407789 - 35407735
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| || ||||| |||||||||||||    
35407789 gctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg 35407735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35498417 - 35498471
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| || |||||||||| ||||||||  |||||||||||||| ||||||    
35498417 gctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg 35498471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40370286 - 40370340
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| |||||||| |||||||| ||||    
40370286 gctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg 40370340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||| ||| |||||||||||||||||||||| |||||||||||    
50009029 gtccatgaccccacttttgtgatgatttgcacacgtggcacat 50009071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 50009283 - 50009229
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| || |||||| |||| |||||||||||||||||||| ||||| ||||||    
50009283 gctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg 50009229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 50261935 - 50261885
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||  |||||||||||||||||||||  || ||||||||||||||    
50261935 gctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc 50261885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
52342509 ttttggtccctgcaaatatgcctcattttggttttggtccctg 52342467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 53113444 - 53113490
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt 89  Q
    ||||||||| |||||| ||||||||||||||| ||||||||| ||||    
53113444 gctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt 53113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 53701362 - 53701416
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| || ||||||||||||||  |||| |||||||||||||    
53701362 gctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctg 53701416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 8940406 - 8940361
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
8940406 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 8940361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||  ||||||||||||||||||||| ||||| ||||| || |||||||    
9603738 gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac 9603791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #264
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 11463362 - 11463313
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
11463362 ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 11463313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #265
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 12741026 - 12741071
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
12741026 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 12741071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #266
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 14772330 - 14772383
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 211  Q
    |||||||||||||||||||| | ||||||||||| || | |||||| |||||||    
14772330 cccacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt 14772383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #267
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 16679857 - 16679796
Alignment:
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||| | || ||||||||||||||||| ||||||||||  || |||||||| ||||    
16679857 tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt 16679796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #268
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 98
Target Start/End: Original strand, 20644584 - 20644621
Alignment:
61 tccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||||||| |||||||||||||| ||||||||    
20644584 tccctgcaaatatgtctcgttttggttttggtccctgg 20644621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #269
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| ||||||||||||||||||||| | || ||||| |||||||||    
20807800 taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc 20807849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #270
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 22008771 - 22008726
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
22008771 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22008726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #271
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 22016289 - 22016244
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
22016289 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22016244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #272
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 80
Target Start/End: Complemental strand, 26273823 - 26273786
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgt 80  Q
    ||||||||| |||||||||||| |||||||||||||||    
26273823 gctaaaatatggttttagtcccagcaaatatgcctcgt 26273786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||||||||||||||| ||| |||||||||| ||||||    
28452303 ttttagtccctgcaaatatgtctcattttggttttggtccct 28452262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 29678386 - 29678333
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| | |||| |||||||||||||||||  ||||||||||||| ||||    
29678386 gctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct 29678333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Complemental strand, 33794788 - 33794751
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||||||||||||||||  ||||||||||||    
33794788 gtccctgcaaatatgcctcgttttaattttagtccctg 33794751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| ||||||||||||||| ||  |||||||||||||    
36673244 gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt 36673195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||| ||||||||||| || |||||||| ||||    
40370465 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40370420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #278
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||||||| |||||||||| ||||||    
40370515 ttttggtccctgcaaatatgcctcattttggttttggtccct 40370474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #279
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Original strand, 40560492 - 40560529
Alignment:
60 gtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||||||||||||||||  ||||||||||||    
40560492 gtccctgcaaatatgcctcgttttaattttagtccctg 40560529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 45002140 - 45002185
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
45002140 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 45002185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 45006005 - 45006054
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
45006005 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 45006054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 98; Significance: 7e-48; HSPs: 232)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 44508721 - 44508905
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||             |    
44508721 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccctgcaaaaatttttgtttttg 44508820  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
44508821 aaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtagtttttggtccctgc 44508905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45073640 - 45073456
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||             |    
45073640 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg 45073541  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45073540 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 45073456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 7431952 - 7432138
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||  ||||           ||||||||||||||||||||                
7431952 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 7432051  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7432052 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 7432138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35015219 - 35015033
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||         ||  ||||||||||||||||||                
35015219 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgtttt 35015120  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35015119 tgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 35015033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 17999720 - 17999538
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||             |    
17999720 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttg 17999623  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17999622 aaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 17999538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 37372903 - 37372719
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||           ||||||||||||||||||||             |    
37372903 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 37372804  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
37372803 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtagtttttggtccctgc 37372719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1007228 - 1007043
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||| |||||||||||||||||| ||||||||| ||||          ||||||||||||||||||||                 
1007228 gctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 1007129  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
1007128 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 1007043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 44344788 - 44344605
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |         ||||||||||||||||||||             |    
44344788 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg 44344690  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||    
44344689 aaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaattttatagtttttggtccctgc 44344605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45021495 - 45021682
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttgg-ttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |           ||||||||| ||||||||||               
45021495 gctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccctgcaaaattttttgttt 45021594  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45021595 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 45021682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 6108596 - 6108511
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6108596 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 6108511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 39719455 - 39719540
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39719455 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 39719540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 28911578 - 28911764
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||             ||||||||||||||||||||                
28911578 gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 28911677  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
28911678 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtagtttttggtccctgc 28911764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19783816 - 19784001
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    |||||||||  ||||||||||||||||||||| ||||||||||||||||||| ||           || ||||||||||||||||||                 
19783816 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtccctgcaaatttttttgttttt 19783915  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
19783916 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggttcctgc 19784001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 30352563 - 30352743
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||         ||  |||||| |||||||||||             |    
30352563 taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaattttttgtttttg 30352662  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30352663 aaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 30352743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1559704 - 1559520
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||  ||||||||||||           ||||||||||||| ||||||             |    
1559704 gctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 1559605  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||    
1559604 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttataatttttggtccctgc 1559520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 12894301 - 12894216
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12894301 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 12894216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 31732350 - 31732265
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31732350 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 31732265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 48359074 - 48358891
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| | || |         ||||||||| ||||||||||                  
48359074 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttg-taaaaaaaaattgtttttgatccctgcaaaattttttgtttttt 48358976  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48358975 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 48358891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 18022357 - 18022552
Alignment:
32 atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn 131  Q
    |||||| | ||||||||||| |||||||||||| ||||||||| ||||||||||||||||| |||            ||||||||||||||||||||       
18022357 atataatcaaagctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcctataaaaaaaaaattgtttttggtccctgcaaaatt 18022456  T
132 nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
               |||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18022457 ttttattttttaaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 18022552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 19561155 - 19561333
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| |              ||||||||||||||||||||             |    
19561155 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc-----aaaaaaattttgtttttggtccctgcaaaattttttgtttttg 19561249  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    ||||||||||||||  ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
19561250 aaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctg 19561333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 21223508 - 21223592
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21223508 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 21223592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 54 - 227
Target Start/End: Complemental strand, 5308675 - 5308501
Alignment:
54 gttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtcc 152  Q
    |||||||||||||||||||| |||||||||||||||||||||||           || ||||||||||||||||||             ||||||||||     
5308675 gttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttttgaaaatagtct 5308576  T
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5308575 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 5308501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 21554752 - 21554567
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||            ||||||||||||||||||||                 
21554752 gctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 21554653  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||||||    
21554652 gaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtagtttttgatccctgc 21554567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 39832907 - 39833090
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |         ||||||||||||||| ||||             |    
39832907 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctacaaatttttttgtttttg 39833005  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||| ||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||| ||||||||    
39833006 aaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttngtagtttttagtccctgc 39833090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 488814 - 488899
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
488814 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 488899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 18311682 - 18311766
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
18311682 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttggtccctgc 18311766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 44403248 - 44403067
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||| |||||||||| |||||||||||||||||||||            |||||||||||| |||||||             |    
44403248 gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctataaaaaaaaaattgtttttggtcactgcaaa--aaattgttttag 44403151  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
44403150 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtagtttttggtccctg 44403067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 142 - 222
Target Start/End: Complemental strand, 46304281 - 46304201
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 222  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46304281 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 46304201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19757749 - 19757936
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    |         ||||||||||||| ||||||               
19757749 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttgttttgtttttggtccttgcaaattcttttgttt 19757848  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      |||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
19757849 ttgaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 19757936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 45 - 211
Target Start/End: Original strand, 30709328 - 30709494
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa 144  Q
    ||||||| | ||||||||||| |||||||||||||||||||||||||||| ||           ||||||||||||||||||||             |||    
30709328 taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 30709427  T
145 aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 211  Q
    |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30709428 aatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 30709494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 35210411 - 35210326
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| | | ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
35210411 gaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc 35210326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 10358105 - 10358189
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||    
10358105 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttgatccctgc 10358189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 31310577 - 31310493
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||    
31310577 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtagtttttggtccctgc 31310493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 219
Target Start/End: Original strand, 14738700 - 14738777
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    |||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
14738700 gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtaatttttg 14738777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 20388275 - 20388456
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnt-tgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||           | |||||||||||||||||||                 
20388275 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaaatctgtttttggtccctgcaaaattttttgtcttt 20388374  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||| ||||| |||| |||||||||||||||||||||||||| || || |||||||| |||||||||||||||||||    
20388375 taaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtagtttttggtcc 20388456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13769775 - 13769957
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||| || |         ||||||||||||| ||||||                  
13769775 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg-taaaaaaaaattgtttttggtccttgcaaaattttttgtttttt 13769873  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| || | ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
13769874 aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc 13769957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 207
Target Start/End: Complemental strand, 25547489 - 25547325
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||           ||||||||||||| ||||||             |    
25547489 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 25547390  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaatt 207  Q
    ||||||||| |||| |||| ||||||||||||||||||||||| |||||||||||||||||||||    
25547389 aaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaatt 25547325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 19465735 - 19465804
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
19465735 cccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 19465804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 1006836 - 1006892
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
1006836 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 1006892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 6108335 - 6108391
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6108335 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 6108391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 23816933 - 23816849
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| ||||||||||||||| ||||||||||||| || ||| |||| |||||||||||||||||||||||    
23816933 aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc 23816849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 44509053 - 44508997
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
44509053 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 44508997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 1974207 - 1974140
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| ||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||    
1974207 cactattgtgatgatttgcatacgtgacaaattataactgaaccaattttttagtttttggtccctgc 1974140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 205
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 205  Q
    |||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
22871162 gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22871225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12894401 - 12894347
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
12894401 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 12894347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28911905 - 28911851
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
28911905 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28911851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 6079808 - 6079864
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||    
6079808 aagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 6079864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 46648516 - 46648599
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| |||||||||||||||| |||||||||||| || |||||||| |||||||||||||| ||||||||    
46648516 aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtagtttttagtccctgc 46648599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1614903 - 1614849
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
1614903 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1614849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3975550 - 3975604
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
3975550 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3975604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6509209 - 6509263
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||    
6509209 gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg 6509263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6509469 - 6509415
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
6509469 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 6509415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8144657 - 8144603
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
8144657 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8144603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8555798 - 8555744
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
8555798 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 8555744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9659688 - 9659634
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
9659688 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 9659634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10358367 - 10358313
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
10358367 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 10358313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16853588 - 16853534
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
16853588 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16853534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17999466 - 17999520
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||    
17999466 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg 17999520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19561449 - 19561395
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
19561449 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 19561395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23399613 - 23399667
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
23399613 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23399667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23676451 - 23676397
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
23676451 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23676397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25988748 - 25988694
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
25988748 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26878070 - 26878016
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
26878070 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 26878016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29198661 - 29198607
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
29198661 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29198607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35210514 - 35210460
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||    
35210514 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 35210460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39833235 - 39833181
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||    
39833235 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 39833181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45228917 - 45228863
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
45228917 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 45228863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48192487 - 48192433
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
48192487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 21223747 - 21223694
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
21223747 gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 21223694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||| ||||||||||||||||||||||||||||||||||    
32189388 ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg 32189335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 14739003 - 14738947
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||    
14739003 gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt 14738947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 30352903 - 30352847
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    |||||||||  ||||||||||||||||||||||||||||||| ||||||||||||||    
30352903 gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt 30352847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 43300730 - 43300794
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||| |||||||||||||||||||||| || |||||||| ||| |||||||||||||||||||    
43300730 ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtagtttttggtccctgc 43300794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
48192260 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3975837 - 3975786
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||||||||    
3975837 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 3975786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18022703 - 18022652
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||||    
18022703 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc 18022652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||    
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 37372492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1614560 - 1614614
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
1614560 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1614614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1974010 - 1974064
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||  |||||||||||||||||||||    
1974010 gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 1974064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5233809 - 5233863
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
5233809 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 5233863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5354769 - 5354823
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||    
5354769 gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg 5354823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8144296 - 8144350
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
8144296 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8144350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10358002 - 10358056
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | | |||||||||||||||||||||||||||||||||||||||||    
10358002 gctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg 10358056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13770080 - 13770026
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||    
13770080 gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg 13770026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23399975 - 23399921
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
23399975 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23399921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 23816671 - 23816721
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||    
23816671 gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 23816721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25092161 - 25092215
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
25092161 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25092215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25092547 - 25092493
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
25092547 gctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg 25092493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25988386 - 25988440
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
25988386 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25988440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27037594 - 27037648
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
27037594 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 27037648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27458400 - 27458454
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
27458400 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 27458454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31732102 - 31732156
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||    
31732102 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg 31732156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 35104290 - 35104240
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||||    
35104290 aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35104240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35665878 - 35665932
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||    
35665878 gctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg 35665932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35838336 - 35838282
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35838336 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35838282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39719641 - 39719587
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| |||||||| |||||||||||||    
39719641 gctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg 39719587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41054235 - 41054181
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
41054235 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 41054181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44402961 - 44403015
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||| | ||||||||||||||||||    
44402961 gctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg 44403015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45073315 - 45073369
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||    
45073315 gctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg 45073369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||||||||||| ||| ||||||||||||||||||    
17854151 ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg 17854204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 32189278 - 32189209
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||| |||||||||||||||||||  |||||||| || | |||||| |||||||||||||||||||||||    
32189278 cccatttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtagtttttggtccctgc 32189209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 45021855 - 45021806
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||    
45021855 gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 45021806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 1271588 - 1271544
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| ||||||||||||||||||||||||||||||||||||||    
1271588 ggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1271544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 689 - 753
Target Start/End: Original strand, 6726083 - 6726147
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacaccc 753  Q
    |||||||||||||||||||||||||||||||| ||||||| | | ||| |||| |||||||||||    
6726083 agacgaacagagatcggtgaaactgagaatacaaacaaaaaacgccgtatataggcggaacaccc 6726147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||| ||||||||||||||||||    
16941049 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16940997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
23676135 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23676187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 41365094 - 41365031
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||||||| |||||||| || |||||||| ||||||||| |||||||||||||    
41365094 ttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtag-ttttggtccctgc 41365031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 45671314 - 45671394
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||| ||||||| | || ||||||||||||||||||||||| ||||| || |||||||  |||||||||||||| ||||    
45671314 aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtagttttttgtcc 45671394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 6589022 - 6589073
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||| ||||    
6589022 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc 6589073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| |||||| |||||||||||||||||||||||||||||| ||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct 11766971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21554394 - 21554445
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||||||||||| |||||||||||||||||||||||||||    
21554394 gctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc 21554445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||    
25547256 taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 25547303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 30223794 - 30223743
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||| ||||||||||||||||||||||||||||||    
30223794 gctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc 30223743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 35837925 - 35837976
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||    
35837925 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 35837976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||| |||||||||||| |||||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc 43300664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46304087 - 46304138
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||||| ||||||||||||||||||||||||||||||||    
46304087 gctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc 46304138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 46648714 - 46648667
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||    
46648714 gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46759659 - 46759710
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||||||||||||||||||    
46759659 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 46759710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 48852445 - 48852496
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||||||||||||||||||||| ||||||||||    
48852445 gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc 48852496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1559344 - 1559398
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||||||||||||||||||||| ||||| ||||||    
1559344 gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg 1559398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2945844 - 2945790
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||||| |||||||||||||||||||||||||||||||    
2945844 gctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg 2945790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5234203 - 5234149
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| ||||||||||||||||||||||    
5234203 gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 5234149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5308324 - 5308378
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||| |||||||| |||||||||||||    
5308324 gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg 5308378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11767274 - 11767220
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| || ||||||||||||||||||    
11767274 gctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg 11767220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12932782 - 12932728
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||||||||||||| ||||||||||||    
12932782 gctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg 12932728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16940763 - 16940817
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||| |||||| |||||||||||||||||||| |||||||||||||||||    
16940763 gctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg 16940817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 21223406 - 21223456
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | ||||||||||||||||||||| |||||||||||||||||    
21223406 gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc 21223456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28262714 - 28262768
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||||||||| ||||||    
28262714 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg 28262768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29198304 - 29198358
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||  ||||||||||||||||||||||    
29198304 gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 29198358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30223462 - 30223516
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||| ||||||||| ||||||||||||||||||||||    
30223462 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 30223516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 30709643 - 30709593
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||||||||||||||||||| ||||||||||||||||||    
30709643 gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 30709593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 39438742 - 39438792
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||| ||||||||||||||||||||||||||    
39438742 gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 39438792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39439028 - 39438974
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||    
39439028 gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 39438974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 39719354 - 39719404
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||| |||||||||||| ||||||||||||||    
39719354 gctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc 39719404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41053843 - 41053897
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||| ||||| ||||||||||||    
41053843 gctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg 41053897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44568327 - 44568381
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||  ||||||||||||||||||||||    
44568327 gctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg 44568381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44568689 - 44568635
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
44568689 gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 44568635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46304383 - 46304329
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||||||||||||||||||  |||||||||||||||||||||    
46304383 gctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg 46304329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46759941 - 46759887
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| ||||||||||||||||||||||    
46759941 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg 46759887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46828945 - 46828999
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| || |||||||||||||||||||    
46828945 gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 46828999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||| |||||| |||||||||||||||||| ||||||||||||||||    
6589271 taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc 6589222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||| |||||| |||||||||||||||| |||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 6847068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 18311579 - 18311628
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||| |||||||||| || ||||||||||||||||||||||||    
18311579 aagctaaaatatggttttagtctctacaaatatgcctcgttttggtttta 18311628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt 88  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||    
31310678 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt 31310633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||| |||||||||||||||||||||||||||| ||||| || |||||||    
35665984 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac 35666037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| ||||||||| || |||||||||||||||||||||||||||    
41365213 gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt 41365164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 5355106 - 5355066
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||| ||||||||||||||||||||||||||||||||||    
5355106 ggttttggtccctgcaaatatgcctcgttttggttttagtc 5355066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
57 ttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||||||||||||||||||||| ||||||    
12894056 ttagtccctgcaaatatgcctcgttttggttttaatccctg 12894096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 97
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
57 ttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||||||||||||||| ||||||||||||||||||    
19758044 ttagtccctgcaaatatgcctcattttggttttagtccctg 19758004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||||||||||||||||||| ||||||||| ||||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 31503732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 31732450 - 31732402
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag 91  Q
    ||||||||| ||||||||||| |||||||||||||||||||| ||||||    
31732450 gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag 31732402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||||||||||||| |||||| |||||    
38186369 taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg 38186421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||  |||||||||||||||||||||||| ||||||||||||    
44841359 taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg 44841411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 689 - 768
Target Start/End: Complemental strand, 8745546 - 8745467
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaataaacacccct 768  Q
    |||||||||||||  ||||||||||| ||||  ||||| ||| | ||| |||| ||||||||||||||| ||||||||||    
8745546 agacgaacagagactggtgaaactgaaaatagaaacaagagacgccgtatataggcggaacacccgaaaaaaacacccct 8745467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 9659464 - 9659523
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
9659464 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9659523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14543711 - 14543762
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| ||| |||||||||||||||    
14543711 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 14543762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 14738613 - 14738652
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||||||||||||||||||| |||||||||||||||    
14738613 ttttagtccctgcaaatatgcctcattttggttttagtcc 14738652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 32189077 - 32189124
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| | ||||||||||||||||||||| ||||||||||||||    
32189077 gctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| |||||| ||||||| ||||||| |||||||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct 34877828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 489071 - 489017
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||| ||||||||||| ||||||||| ||||||||||||    
489071 gctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg 489017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 7432249 - 7432195
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||| ||||||| | |||||||||||||||||||||| |||||||| |||||    
7432249 taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggt 7432195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9659356 - 9659410
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||| ||||||||||||    
9659356 gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 9659410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19465979 - 19465926
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||| ||||||||||||| ||||||| ||||||||||||||    
19465979 gctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg 19465926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20388674 - 20388620
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| ||| ||||||||||||||||| ||||||| ||||    
20388674 gctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg 20388620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 24954049 - 24953979
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||  ||| | ||||||| |||||||||||||| ||||||||| || |||||||| |||||||||    
24954049 aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag 24953979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26877679 - 26877733
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  || ||||||||||| ||||||||||||||||||||||    
26877679 gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg 26877733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31310366 - 31310416
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||||||||||||||||||  ||||||||||||||||||    
31310366 gctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc 31310416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 727
Target Start/End: Complemental strand, 33719382 - 33719344
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaa 727  Q
    |||||||||||||||||||||||||||||||| ||||||    
33719382 agacgaacagagatcggtgaaactgagaatacaaacaaa 33719344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 35104091 - 35104133
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||| ||||||||||||||||||||||    
35104091 ttttggtccctgcaaatatgtctcgttttggttttagtccctg 35104133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35470279 - 35470225
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  ||||||  |||||||||||||||||| ||||||||||||||||||    
35470279 gctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg 35470225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| || |||||||||||||||||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg 37527367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39520399 - 39520453
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| | |||||||| ||||||||||||||||||||||    
39520399 gctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg 39520453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| ||||||||||||||||||    
41054163 ttttggtccctgcaaatatgcctcattttggttttagtccctg 41054121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41364885 - 41364939
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| || || |||||||| ||||||||||||||||||||||    
41364885 gctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg 41364939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44958505 - 44958451
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||||| |||||||| ||||||||||||||||||||||    
44958505 gctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg 44958451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45228616 - 45228670
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| | ||| |||||||||||||||||| |||||||||||||    
45228616 gctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg 45228670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46829311 - 46829257
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||| ||||||||||||||||||    
46829311 gctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg 46829257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 5354999 - 5354950
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
5354999 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5354950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 6892266 - 6892205
Alignment:
36 aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| ||||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||    
6892266 aaactaggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg 6892205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 11767036 - 11767085
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
11767036 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 11767085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 24717531 - 24717478
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |||||| | |||||| |||||||||||||||||||||    
24717531 gctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct 24717478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 94
Target Start/End: Original strand, 24953831 - 24953872
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||||||||||||||||| | ||||||||||||||||    
24953831 ggttttagtccctgcaaatatgcattgttttggttttagtcc 24953872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 30223580 - 30223629
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
30223580 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 30223629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 35104125 - 35104186
Alignment:
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||  ||||||||||||||||||||| ||||||||||| ||  ||||||| ||||    
35104125 tagtccctgactccacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt 35104186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||| ||||||| ||  ||||||||||||||||||    
37952671 ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg 37952724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 38186642 - 38186589
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||||||||| ||||| ||||| || |||||||| |||||||||    
38186642 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag 38186589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 39520517 - 39520566
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
39520517 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 39520566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 689 - 781
Target Start/End: Original strand, 42532923 - 42533015
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc-cgaaataaacacccctaaaaacacccttg 781  Q
    ||||||||||||| ||||| |||||||||||| | ||||||  | ||| |||| ||||||||||  |||||||||| |||||||||| ||||||    
42532923 agacgaacagagaccggtggaactgagaatacaaccaaaaggcgccgtatataggcggaacacctggaaataaaca-ccctaaaaactcccttg 42533015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||  ||||||||||||||||||||| || |||||| ||||||||||||    
43058752 ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg 43058805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #190
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||||||||||||||||||| ||||||||  ||||||||    
18891562 taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc 18891514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #191
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Complemental strand, 37952950 - 37952902
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||||| ||| |||||||||||||| |||||||||||| ||||||    
37952950 aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacat 37952902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||||||||||| ||||||| || |||||||||||||||    
37953048 taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc 37953000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| |||| |||||||||| ||||||||| ||||||||||||    
39520727 taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg 39520675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| ||||||||||| |||||||||| |||||||| |||||||| ||||    
45671217 taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg 45671269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 96
Target Start/End: Complemental strand, 45671558 - 45671494
Alignment:
32 atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||| || | ||||||| ||||||||||  |||||||||| |||||||| ||||||||||||    
45671558 atataaaataggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct 45671494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 6911246 - 6911199
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| |||||| || ||||||||||| ||||||||||||||||    
6911246 gctaaaatatggttttggttcctgcaaatatacctcgttttggtttta 6911199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #197
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
46 aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||| |||||| ||||||||||||||  ||||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc 6954909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #198
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 16940881 - 16940924
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
16940881 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 16940924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #199
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 27458472 - 27458515
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
27458472 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 27458515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #200
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 34878124 - 34878077
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| ||||||  |||||||||||||| |||||||||||||||    
34878124 gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 34878077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #201
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
161 acttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||| ||||||||||| || |||||||| ||||    
35470159 acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35470112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #202
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 35470207 - 35470164
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
35470207 tttttgtccctgcaaatatgcctcattttggttttggtccctgg 35470164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #203
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 35838033 - 35838092
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||| ||| ||||    
35838033 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactggacccattt 35838092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #204
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 41054103 - 41054060
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
41054103 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 41054060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #205
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 46759864 - 46759805
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
46759864 gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 46759805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacat 191  Q
    |||||||  |||||||||||||||||||||| |||||||||||    
2945736 gtccctggccccacttttgtgatgatttgcacacgtggcacat 2945694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3807865 - 3807919
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| || |||||||||||| ||||||||||||||||| ||||    
3807865 gctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg 3807919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||| ||||||||||||||| ||||||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagtc 3808068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
3975766 ttttggtccctgcaaatatgcctcattttggttttggtccctg 3975724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Complemental strand, 7431975 - 7431945
Alignment:
296 cagggactaaaaccatattttagccaataaa 326  Q
    |||||||||||||||||||||||||||||||    
7431975 cagggactaaaaccatattttagccaataaa 7431945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #211
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
9659428 ttttggtccctgcaaatatgcctcattttggttttggtccctg 9659470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #212
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 186
Target Start/End: Complemental strand, 17854356 - 17854314
Alignment:
144 aaatagtccctgaacccacttttgtgatgatttgcatacgtgg 186  Q
    |||||||||||||  ||| ||||||||||||||||||||||||    
17854356 aaatagtccctgactccatttttgtgatgatttgcatacgtgg 17854314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #213
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 18927090 - 18927040
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||  ||||||||||||||||||||| ||| |||| |||||||||    
18927090 gctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc 18927040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #214
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22539931 - 22539985
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||||| |||||||||||| ||||||||||||| ||||    
22539931 gctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg 22539985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #215
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23817033 - 23816979
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| ||| ||||||| ||||||||||| ||||| ||||    
23817033 gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg 23816979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 97
Target Start/End: Complemental strand, 27458698 - 27458664
Alignment:
63 cctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||||||||||||| |||||||||||||    
27458698 cctgcaaatatgcctcgttttagttttagtccctg 27458664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28528906 - 28528960
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||| ||||||| ||||||| ||||||||||||||    
28528906 gctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg 28528960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35210183 - 35210237
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | ||||  |||| ||||||||| ||||||||||||||||||||||    
35210183 gctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg 35210237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #219
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 35469881 - 35469931
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||  ||||||||||||||  |||||||||||||||||    
35469881 gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc 35469931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #220
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 38186747 - 38186709
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||| ||||||||||||||| ||||||||||||||||||    
38186747 ttttggtccctgcaaatatgtctcgttttggttttagtc 38186709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #221
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 38486673 - 38486631
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||||||||||||||| ||||||||||| || |||||||    
38486673 cacttttgtgatgatttgcacacgtggcacatgatgactgaac 38486631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #222
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 38486789 - 38486739
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||  |||||| ||||||||| ||||||||||||||||    
38486789 gctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc 38486739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #223
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 44841473 - 44841523
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||| | ||||||||||| || |||||||| ||||    
44841473 cccacttttgtgatgatttggacacgtggcacatgatgactgaacccattt 44841523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #224
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48854069 - 48854015
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | ||||  ||||||||||||||  |||||||||||||||||||||    
48854069 gctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg 48854015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 3975730 - 3975677
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    ||||||||  |||||||||| |||||||||| ||||||||||| || |||||||    
3975730 gtccctgactccacttttgtaatgatttgcacacgtggcacatgatgactgaac 3975677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 6589080 - 6589129
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
6589080 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 6589129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 18926889 - 18926942
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||||| | | |||||||| ||||||||||||| ||||||||    
18926889 ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg 18926942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #228
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 27458518 - 27458567
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
27458518 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 27458567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #229
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 31732125 - 31732096
Alignment:
296 cagggactaaaaccatattttagccaataa 325  Q
    ||||||||||||||||||||||||||||||    
31732125 cagggactaaaaccatattttagccaataa 31732096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #230
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 34877885 - 34877942
Alignment:
152 cctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 209  Q
    ||||| |||||||||||||||||||||| ||| ||||||| || | |||||| |||||    
34877885 cctgaccccacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt 34877942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #231
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 41054057 - 41054008
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| | ||||||||| || |||||||| ||||    
41054057 ccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 41054008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #232
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 45228707 - 45228752
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||| ||||||||||| || |||||||| ||||    
45228707 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 45228752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 97; Significance: 3e-47; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8548 - 8734
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
8548 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 8647  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8648 tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 8734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 91; Significance: 1e-43; HSPs: 214)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 6146950 - 6146762
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnn 138  Q
    ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||           ||  ||||||||||||||||||              
6146950 aagctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaatttttttgtt 6146851  T
139 nnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
       ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6146850 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 6146762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 1525797 - 1525996
Alignment:
30 ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaa 127  Q
    |||||||||  | ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||            |||||||||||||||||||    
1525797 ttatataaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaa 1525896  T
128 acnnnnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |             ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
1525897 aattttttgtttttgaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtagtttttggtccctgc 1525996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 218
Target Start/End: Original strand, 4375693 - 4375867
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |         ||||||||||||||||||||             |    
4375693 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 4375791  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 218  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4375792 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 4375867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 33636323 - 33636509
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |||         ||  ||||||||||||||||||                
33636323 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaattttttgtttt 33636422  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
33636423 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtagtttttggtccctgc 33636509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19494120 - 19494305
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||         || ||||||||||||||||||                 
19494120 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggtttt 19494219  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||    
19494220 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttctagtccctgc 19494305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38930303 - 38930488
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||| ||||||| ||||||||||||||||| ||||||         || ||||||||||||||||||                 
38930303 gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt 38930402  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
38930403 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcgctgc 38930488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 41 - 223
Target Start/End: Original strand, 4016904 - 4017085
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||           | ||||||||||||||||||                
4016904 aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaaaaaaaaat-gtttttggtccctgcaaaattttttgtttt 4017002  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
      |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4017003 ttaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 4017085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 16644043 - 16643858
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||         ||  ||||||||||||||||||                
16644043 gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaattttttgtttt 16643944  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
     ||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
16643943 tgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttggtccctg 16643858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 16789368 - 16789187
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||| |||||             |    
16789368 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtcccagcaaa---attttgttttg 16789272  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    || ||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
16789271 aatatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccctgc 16789187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 6146515 - 6146701
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||           ||||||||||||||||||||                
6146515 aagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 6146614  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  || |||||||||||||||    
6146615 tgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattaggttgtttttggtccctgc 6146701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 28399034 - 28398853
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| | ||||||||||||||||||||  |||||||||||||||||||||           ||||||||||||||||||||             |    
28399034 gctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg---taaaaaaattgtttttggtccctgcaaaattttttgtttttg 28398938  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
28398937 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 28398853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 24187570 - 24187753
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |         |||||||||| || ||||||             |    
24187570 gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg-taaaaaaaaattgtttttggcccgtgcaaatttttttgtttttg 24187668  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
24187669 aaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtagtttttggtccctgc 24187753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 24955009 - 24954825
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||         || |||||||||| ||||||             |    
24955009 gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaaaaaaaattatttttggtccttgcaaaaaaatttgtttttg 24954910  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||||||||||||||||||||||| ||| |||||||||||  ||||||||||||||||||||||||||||    
24954909 aaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataacaaaaccaattttgtagtttttggtccctgc 24954825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8094480 - 8094666
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||          |  ||||||||||||||||||                
8094480 gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaattttttgtttt 8094579  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
8094580 tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 8094666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 25131112 - 25131294
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||           ||| ||||||||||||||||             |    
25131112 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaatattgattttggtccctgcaaa-tttttttgttttg 25131210  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    |||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
25131211 aaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctg 25131294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 1162910 - 1163098
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||           ||||||||||||||||||||                
1162910 gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtgtt 1163009  T
141 n--gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
       |||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
1163010 tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 1163098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 1408352 - 1408172
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||| |||| ||||||||||||            ||||||||||||||||||||             |    
1408352 gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttatttttg 1408253  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||    
1408252 aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaattttatagtttttggtcc 1408172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14495299 - 14495214
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||    
14495299 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtagtttttggtccctgc 14495214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 21509796 - 21509881
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||    
21509796 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtagtttttgatccctgc 21509881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 22917826 - 22917741
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
22917826 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc 22917741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 21125919 - 21125835
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
21125919 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc 21125835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 10776498 - 10776313
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||             |||||||| |||||||||||                
10776498 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaattttttgtttt 10776399  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
     ||||||||||| ||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||    
10776398 tgaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtagtttttggtccctg 10776313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 27341590 - 27341404
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgt--ttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           || |  ||||||||||||||||                
27341590 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttgtttt 27341491  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||| |||| |||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
27341490 tgaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaattttgtagtttttggtccctgc 27341404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 22650568 - 22650651
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||    
22650568 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtagtttttggtccct 22650651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 7272522 - 7272607
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||   ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
7272522 gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtagtttttggtccctgc 7272607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 14488717 - 14488901
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    |||||||||  ||||||||||||| |||||||||||||||||||||||||| |||           ||||||||||||| ||||||             |    
14488717 gctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaaaaaaaaatttgtttttggtccttgcaaatttttttgtttttg 14488816  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||| ||||||||| || |||||||| |||||||||||||||||||||||    
14488817 aaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagtttttggtccctgc 14488901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29488109 - 29487925
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||           ||||||||||||||||||||                  
29488109 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttt 29488010  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| ||||||||||||||||||| ||||||||| || ||||||||  ||||||||||||||||||||||    
29488009 aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtagtttttggtccctgc 29487925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 32040272 - 32040187
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||    
32040272 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtagtttttgatccctgc 32040187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 15719758 - 15719842
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
15719758 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc 15719842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 43 - 205
Target Start/End: Original strand, 40492961 - 40493117
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||           || |||||||||||||||||             |    
40492961 gctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg------taattttttttttggtccctgcaaaattttttgtttttg 40493054  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 205  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
40493055 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 40493117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 43 - 222
Target Start/End: Original strand, 40066498 - 40066675
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||||||| |||| |         ||||||||||||| ||||||             |    
40066498 gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg-taaaaaaaaattgtttttggtcc-tgcaaaattttttgtttttg 40066595  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc 222  Q
    ||||||||| |||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| || |||||||||    
40066596 aaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttataatttttggtc 40066675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 14238752 - 14238932
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |          ||||||||||||| ||||||                 
14238752 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtcc-tgcaaaattatttgttttt 14238850  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
     |||||||||||||| |||| ||||||||||||||||||||||||||| | || |||||||| |||||||||||||||||||    
14238851 taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtagtttttggtcc 14238932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 18549305 - 18549390
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||||||||||    
18549305 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtagtttttggtccctgc 18549390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 30337023 - 30337108
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| |||||||||||||||||||||||| | || || |||||||| |||||||||||||||||||||||    
30337023 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtagtttttggtccctgc 30337108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 10755429 - 10755345
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||  ||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
10755429 aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc 10755345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 19963099 - 19963179
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| |||| |||||||||||||||||||||||| | || ||||||||||| |||||||||||||||||||    
19963099 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtagtttttggtcc 19963179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29158355 - 29158541
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||             ||||||||| ||||||||||                
29158355 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaattttttgtttt 29158454  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||| || | |||||||||||||| ||||  ||||||| |||| ||||||||||||||||||||||||||||||||||||    
29158455 tgaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaattttgtagtttttggtccctgc 29158541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 32418577 - 32418493
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||||||||||    
32418577 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc 32418493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 33526155 - 33526235
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||||||    
33526155 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttggtcc 33526235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 43727328 - 43727244
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| ||||||||||||||| ||||||||||||| || |||||||| |||||||||||||||||||||||    
43727328 aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 43727244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 45 - 200
Target Start/End: Original strand, 1685117 - 1685274
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt--nnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||           |||||||||||| |||||||             |    
1685117 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtcactgcaaaattttttgcttttg 1685216  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactga 200  Q
    ||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||    
1685217 aaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga 1685274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 31 - 227
Target Start/End: Complemental strand, 7578539 - 7578345
Alignment:
31 tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacn 130  Q
    |||||||  |||||||||||||||||||| | |||||||||||| ||| |||||||||||||||   ||         ||||||||||||||||||||      
7578539 tatataatttaagctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcct--gtaaaaaaaaattgtttttggtccctgcaaaat 7578442  T
131 nnnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
                |||||||||  ||| || | ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||    
7578441 tttttgttttttaaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc 7578345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19494412 - 19494356
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
19494412 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 19494356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 22917565 - 22917621
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
22917565 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 22917621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 35143854 - 35143664
Alignment:
32 atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn 131  Q
    ||||||| || ||||||||| ||||||| ||| || ||||||||||||||||||||||||||||||           ||||||||||||||||||||       
35143854 atataaaataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctgaaaaaaaaaaattgtttttggtccctgcaaaatt 35143755  T
132 nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
               |||||||||| ||| |||| ||||||||||||||||||| ||||||||| ||||| ||||| ||||| |||||||||||||    
35143754 ttttattttttaaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaaccgattttatagtttttggtcc 35143664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 223
Target Start/End: Complemental strand, 40844434 - 40844354
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || | ||| || |||||||||||||||||||    
40844434 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtagtttttggtcc 40844354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 223
Target Start/End: Complemental strand, 43477411 - 43477331
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    |||||||||||||| |||| ||||||||||||||||||||| | ||||| || |||||||| |||||||||||||||||||    
43477411 aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtagtttttggtcc 43477331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14239079 - 14239025
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
14239079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 14239025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43477164 - 43477218
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
43477164 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 43477218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1526171 - 1526115
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
1526171 gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt 1526115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 16643662 - 16643718
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
16643662 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 16643718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 32418319 - 32418370
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
32418319 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 32418370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2728596 - 2728542
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
2728596 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2728542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4017299 - 4017245
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
4017299 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 4017245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4710219 - 4710165
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
4710219 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 4710165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7272750 - 7272696
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
7272750 gctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg 7272696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7326420 - 7326366
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
7326420 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 7326366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11019856 - 11019802
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
11019856 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11019802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11976374 - 11976428
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
11976374 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11976428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14495070 - 14495124
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||    
14495070 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 14495124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28346395 - 28346449
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
28346395 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28346757 - 28346703
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
28346757 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32726270 - 32726216
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
32726270 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 32726216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33526411 - 33526357
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
33526411 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 33526357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 34963301 - 34963355
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
34963301 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 34963355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35097691 - 35097637
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
35097691 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35097637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37536087 - 37536141
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
37536087 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 37536141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40066819 - 40066765
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
40066819 gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg 40066765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40844157 - 40844211
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
40844157 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 40844211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 25131446 - 25131393
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    
25131446 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct 25131393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 8094840 - 8094788
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
8094840 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc 8094788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 38930663 - 38930607
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||    
38930663 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt 38930607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1778565 - 1778619
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
1778565 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3511907 - 3511961
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||||||||||||||||||||||||||    
3511907 gctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg 3511961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3512265 - 3512211
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
3512265 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3512211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4474043 - 4473989
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
4474043 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 4473989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4621353 - 4621299
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||    
4621353 gctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 4621299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7186003 - 7185949
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
7186003 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7185949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7272421 - 7272471
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||    
7272421 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 7272471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7326087 - 7326141
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| |||||||||||||||||||||||||||||||||    
7326087 gctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg 7326141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7420231 - 7420285
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
7420231 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7420285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7420589 - 7420535
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||    
7420589 gctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg 7420535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8298588 - 8298642
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
8298588 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8298642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8298974 - 8298920
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
8298974 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8298920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9496722 - 9496668
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
9496722 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 9496668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10337120 - 10337174
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
10337120 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10337174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10337448 - 10337394
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
10337448 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 10337394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10540781 - 10540727
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
10540781 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 10540727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10872916 - 10872970
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||||||||||||||||||||||||||    
10872916 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 10872970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10873279 - 10873225
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||    
10873279 gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 10873225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11019521 - 11019575
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
11019521 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11019575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14489072 - 14489018
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
14489072 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14489018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 14496817 - 14496991
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||            ||||||||||||| ||||||             |    
14496817 gctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct--ataaaaaaaattgtttttggtccttgcaaaattttttgtttttg 14496914  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 219  Q
    ||||| |||||||| | || ||||||||||||||||||| ||||||||| || |||||||| |||||||| ||||||    
14496915 aaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttg 14496991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16789076 - 16789130
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||    
16789076 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 16789130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 18549202 - 18549252
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||    
18549202 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 18549252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20277693 - 20277747
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
20277693 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 20277747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20984147 - 20984201
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
20984147 gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 20984201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21064320 - 21064374
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||||||||||| |||||||||||||    
21064320 gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 21064374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21125720 - 21125774
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||| ||||||    
21125720 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg 21125774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22650465 - 22650519
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||    
22650465 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 22650519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24090437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24187896 - 24187842
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||||||||||||||||||| ||||||||||||||||||||||    
24187896 gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg 24187842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32725908 - 32725962
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
32725908 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 32725962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34963663 - 34963609
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
34963663 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 34963609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35097329 - 35097383
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35097329 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35097383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35345616 - 35345562
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||    
35345616 gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg 35345562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35346630 - 35346684
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35346630 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35346997 - 35346943
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
35346997 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37536418 - 37536364
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||||||||||||| |||||||||||||||||||||    
37536418 gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 37536364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 42133153 - 42133099
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
42133153 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 42133099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 5357424 - 5357477
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| | |||| |||||||||||||||||||||||||||||||||||||    
5357424 gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct 5357477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 10755527 - 10755474
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||||| |||||    
10755527 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct 10755474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| ||| |||||||| ||||||||||||||||||||||||||||||    
14495389 gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc 14495337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg 18549518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 28323850 - 28323903
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||| |||||||||||||||||| ||||||||||||||||||||    
28323850 gctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct 28323903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 97
Target Start/End: Original strand, 9496336 - 9496396
Alignment:
37 aactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||||| |||||| ||||||||||||||| ||||||||||||||||| ||||    
9496336 aactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 9496396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
11976733 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11976681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13232253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 15719657 - 15719709
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc 95  Q
    ||||||||| |||||||||||||||||||||  ||||||||||||||||||||    
15719657 gctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc 15719709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| | |||| ||||||||||||||||||||||||||||||||||||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 28497564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||||||||||||||||||  ||||||||||||||||||||||    
40844532 taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg 40844480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 20278056 - 20278005
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||| |||||||||||||||||||||||||    
20278056 gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc 20278005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 21064683 - 21064632
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||| |||||||||||||||||||||||||    
21064683 gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc 21064632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 28497363 - 28497422
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||| ||||||||||| || |||||||| ||||    
28497363 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 28497422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33526053 - 33526104
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||| ||| ||||||||||||||    
33526053 gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc 33526104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 35115590 - 35115531
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||||||||||||||||| ||||| || |||||||| ||||    
35115590 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 35115531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2728233 - 2728287
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||| ||||||||||||||||||||||    
2728233 gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg 2728287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4473705 - 4473759
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||    
4473705 gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 4473759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6469281 - 6469335
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| || ||| ||||||||||||||||||||||||||||||||| ||||    
6469281 gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg 6469335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||    
10776150 ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10776196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| || ||| |||||||||||||||||||||||||||||||| |||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg 13779477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17073808 - 17073862
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
17073808 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 17073862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17574462 - 17574408
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||    
17574462 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 17574408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20984509 - 20984455
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| ||||||||||||||||||||||    
20984509 gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 20984455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25600231 - 25600285
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||| ||||    
25600231 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 25600285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35115638 - 35115584
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| ||||||| ||||||||||||||| |||||||    
35115638 gctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg 35115584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42132865 - 42132919
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||||    
42132865 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg 42132919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 10540450 - 10540503
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||||  ||||| ||| |||||||||||||||||||||||||||||||||    
10540450 gctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct 10540503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 13232561 - 13232512
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| ||||||||||||||||||| |||||||||||||    
13232561 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 13232512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 27117975 - 27117922
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||||||||||| |||||||||| ||||||    
27117975 gctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct 27117922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1163273 - 1163217
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||| |||||||||||| |||||| ||||||||| |||||    
1163273 gctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggt 1163217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| ||||||| ||||||||||||||||||||||||||    
9175368 taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 9175320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtt 87  Q
    ||||||||  |||||||||||||||||||||||||||||||||||    
40493156 gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt 40493112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||||||||||||||||| |||||||||| ||||||||    
7420303 ttttagtccctgcaaatatgcctcattttggttttggtccctgg 7420346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 8298696 - 8298755
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
8298696 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 8298755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||||||||||||||||| |||||||||| ||||||||    
13232271 ttttagtccctgcaaatatgcctcattttggttttggtccctgg 13232314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||    
20277765 ttttagtccctgcaaatatgcttcgttttggttttggtccctgg 20277808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||    
21064392 ttttagtccctgcaaatatgcttcgttttggttttggtccctgg 21064435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||| |||||| ||||||||||||||||||| |||||||||||||||    
24814710 aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc 24814757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28497256 - 28497307
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| |||||||||||||||||||||||| ||||||||||    
28497256 gctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc 28497307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29158668 - 29158617
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||| |||||||||||||  |||||||||||||||||||    
29158668 gctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc 29158617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||| | ||||||||||||||||||||||||||||| ||||||||    
33652193 taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt 33652240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| |||||||||||||||||||||||||||||| ||||||||    
42430047 tttttgtccctgcaaatatgcctcgttttggttttggtccctgg 42430004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42430119 - 42430068
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| ||| |||||||||||||||    
42430119 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 42430068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 227
Target Start/End: Original strand, 1686477 - 1686511
Alignment:
193 ataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||||||||||||||||||||||||    
1686477 ataactgaaccaattttgtagtttttggtccctgc 1686511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
3680532 aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg 3680582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3680800 - 3680746
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | ||||  ||||||||||||||||||||||||||||| |||||||    
3680800 gctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg 3680746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4376009 - 4375960
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| ||||||||||||||||||||||| ||| |||||||||||||    
4376009 gctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc 4375960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||||| | |||| |||||||||||||||| |||||||||||||||||    
5357762 gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc 5357712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9175013 - 9175067
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| |||| |||||||||| ||||||||||||||||||||||    
9175013 gctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg 9175067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13154887 - 13154941
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||  ||| |||||||||||||||||||||||||||||||||    
13154887 gctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg 13154941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13155250 - 13155196
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| || |||||||||||| ||||||||||||||| ||||||    
13155250 gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg 13155196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19962996 - 19963050
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||| ||||||| |||||||||| |||||||| |||||||||||||    
19962996 gctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg 19963050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21126020 - 21125966
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  |||||||||| || ||||||| ||||||||||||||||||||||    
21126020 gctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg 21125966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24815067 - 24815013
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| | ||||||||||||| ||| ||||||||||||||||||    
24815067 gctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg 24815013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25600596 - 25600542
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||||  ||||| ||||||||||||||| || |||||||||||||||||||    
25600596 gctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg 25600542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25702513 - 25702567
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||| ||||||||||||||||  ||||||||||||    
25702513 gctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg 25702567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27117754 - 27117808
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||| ||||||||||||    
27117754 gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 27117808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28324180 - 28324126
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| |||||||| || |||||||||||||||||||    
28324180 gctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg 28324126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 29992295 - 29992245
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||  |||||||||||||||||||||||| ||||||||||||    
29992295 aaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg 29992245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32040076 - 32040130
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | | ||||||||||||||||||  |||||||||||||||||||||    
32040076 gctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg 32040130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    |||||||| ||||||||||| |||||||||| |||||||||||||||||||    
43727431 ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc 43727382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 7326205 - 7326254
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
7326205 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7326254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 7420349 - 7420398
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
7420349 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7420398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||  |||||||||||||| ||||||||||||||| ||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg 13779204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||  |||||||||||||||||||| | ||||||||||| ||||||||||    
20277801 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 20277854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||  |||||||||||||||||||| | ||||||||||| ||||||||||    
21064428 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 21064481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt 88  Q
    |||||||||  ||||||||||||||||||||| |||||||||||||    
30337216 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt 30337171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 36044793 - 36044744
Alignment:
41 aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||||| |||||| |||||||||||| || |||||||||||||||    
36044793 aagctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| ||||||||||||||||||||||| | |||||| ||||||| ||||    
43727097 ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg 43727150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #181
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 1408006 - 1408054
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag 91  Q
    ||||||||| ||||||||||| |||||||||| |||||||| |||||||    
1408006 gctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag 1408054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #182
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| ||||||  |||||||||||||| ||||||||||||||||||    
2811778 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 2811730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| ||| |||||||||||||||||||| |||||||||    
29991918 taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc 29991966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
54 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||    
1778917 gttttggtccctgcaaatatgtctcgttttggttttaatccctg 1778874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 2811559 - 2811610
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 209  Q
    |||||||||||||||||||| ||||||||||||| || ||| |||| |||||    
2811559 cccacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt 2811610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4473777 - 4473820
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||||||||||||||||||||||  |||||||||| ||||||||    
4473777 ttttagtccctgcaaatatgccttattttggttttggtccctgg 4473820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 6469557 - 6469498
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| |||||||||||||| ||||  | |||||||||||||| |||||||| ||||    
6469557 gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacccattt 6469498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 10540522 - 10540565
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 98  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
10540522 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 10540565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 96
Target Start/End: Original strand, 14847844 - 14847879
Alignment:
61 tccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||||||||||||||||| |||||||||||||||||    
14847844 tccctgcaaatatgcctcattttggttttagtccct 14847879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
147 tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||||||||| |||||||||||||||||||||| | ||| ||||| || |||||||    
23939654 tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac 23939709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 28258240 - 28258189
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||  | ||||||||||| |||||||||||||||||||    
28258240 gctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc 28258189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #192
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 78
Target Start/End: Original strand, 28398757 - 28398792
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctc 78  Q
    ||||||||| ||||||||||||||||||||||||||    
28398757 gctaaaatatggttttagtccctgcaaatatgcctc 28398792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #193
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29487751 - 29487802
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | |||| |||||||||||||||  ||||||||||||||||||    
29487751 gctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc 29487802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #194
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 29992192 - 29992133
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||| ||||||||||||||||||| || ||||| ||||| || |||||||| ||||    
29992192 gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt 29992133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #195
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 42430011 - 42429952
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||  |||| ||||||||||||||||| ||||||||||| || |||||||| ||||    
42430011 gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 42429952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 44997932 - 44997979
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| | |||| ||||||||||||||||||||||||| |||||    
44997932 gctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta 44997979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 1778683 - 1778725
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaa 201  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
1778683 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 1778725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
8298660 ttttggtccctgcaaatatgcctcattttggttttggtccctg 8298702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 9175254 - 9175204
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| || |||||||| || |||||||| ||||    
9175254 cccacttttgtgatgatttgcacacatggcacatgatgactgaacccattt 9175204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 10873158 - 10873112
Alignment:
163 ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 209  Q
    ||||||||||||||||| ||||||||||| || |||||||| |||||    
10873158 ttttgtgatgatttgcacacgtggcacatgatgactgaacccatttt 10873112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| || ||| |||||||| ||||||||||||||||||||||    
15930933 gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg 15930987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 15931151 - 15931101
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
15931151 cccacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt 15931101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| |||||| |||||||||||||||||| ||||||||||||    
17074095 ttttggtccctacaaatatgcctcgttttgattttagtccctg 17074053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| |||||| |||||||||||||||||| ||||||||||||    
17574175 ttttggtccctacaaatatgcctcgttttgattttagtccctg 17574217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||  ||||||||||||||||||||||    
23939620 ttttggtccctgcaaatatatctcgttttggttttagtccctg 23939662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 26530673 - 26530723
Alignment:
47 aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||| ||||||||||| |||||||||||||| |||| |||||||| ||||    
26530673 aaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg 26530723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||| | ||||||||  |||||||||||||||||||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg 30969453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42429759 - 42429812
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| |||||| ||||||||||||  |||||||||||||||||    
42429759 gctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg 42429812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 44998146 - 44998104
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaa 201  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
44998146 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 44998104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
44998191 ttttggtccctgcaaatatgcctcattttggttttggtccctg 44998149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 4473823 - 4473872
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
4473823 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 4473872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 11976617 - 11976572
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 204  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
11976617 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 11976572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 13232317 - 13232366
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
13232317 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 13232366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #214
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 23939548 - 23939597
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    ||||||||| |||||| ||| ||||||||||| |||||||| ||||||||    
23939548 gctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt 23939597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 85; Significance: 4e-40; HSPs: 2)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1643 - 1457
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |  ||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                
1643 gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 1544  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     |||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
1543 tgaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc 1457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 1312 - 1368
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
1312 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 1368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 85; Significance: 4e-40; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 12183 - 12369
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||           ||  ||||||||||||||||||                
12183 gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttt 12282  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12283 tgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 12369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 12535 - 12484
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||||    
12535 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc 12484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 83; Significance: 7e-39; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 5707 - 5520
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn 139  Q
    ||||||||| |||||||||||||||||||||| || |||||||||||||||||||||            ||||||||||||||||||||               
5707 gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 5608  T
140 nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
      |||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5607 ttgaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 5520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 5400 - 5456
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||    
5400 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt 5456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 79; Significance: 2e-36; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 14698 - 14878
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn 141  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |          ||||||| |||||||| |||                 
14698 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgtttt-ggtccctgtaaaattttttgttttt 14796  T
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14797 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 14878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15011 - 14957
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||    
15011 gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg 14957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 78; Significance: 6e-36; HSPs: 3)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 4311 - 4127
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||           |||||||| |||||||||||                  
4311 gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaatttgtttttcgtccctgcaaaattttttgttttta 4212  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
4211 aaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 4127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 4020 - 4064
Alignment:
53 ggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||||||| |||||||||||||||||||||||||||||||    
4020 ggttttagtccctacaaatatgcctcgttttggttttagtccctg 4064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 327
Target Start/End: Original strand, 4288 - 4319
Alignment:
296 cagggactaaaaccatattttagccaataaac 327  Q
    ||||||||||||||||||||||||||||||||    
4288 cagggactaaaaccatattttagccaataaac 4319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 78; Significance: 6e-36; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3290 - 3106
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||           ||||||||||| ||||||||             |    
3290 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtacctgcaaaattttttgtttttg 3191  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||    
3190 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtagtttttggtccctgc 3106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 77; Significance: 3e-35; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9027 - 8842
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||  ||||||||||||| ||||                
9027 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaattttttgtttt 8928  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
     ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
8927 tgaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc 8842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 8734 - 8787
Alignment:
44 ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 8787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 74; Significance: 2e-33; HSPs: 2)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17942 - 17857
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||    
17942 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtagtttttggtccctgc 17857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18042 - 17988
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||    
18042 gctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg 17988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 71; Significance: 1e-31; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 366272 - 366090
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||                  
366272 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 366175  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| || |||| ||||||||||||||| ||||||||||||| || |||||||| |||||||||||||||||||||||    
366174 aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc 366090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 365980 - 366034
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||    
365980 gctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg 366034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 70; Significance: 4e-31; HSPs: 3)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 10257 - 10338
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc 223  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||    
10257 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc 10338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10169 - 10220
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
10169 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc 10220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10514 - 10460
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||| || |||||||||||||| ||||    
10514 gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg 10460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 213
Target Start/End: Original strand, 5210 - 5382
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||           ||  ||||||||||||| ||||                
5210 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgtttt 5309  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
     |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5310 tgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 213
Target Start/End: Original strand, 5230 - 5402
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn 140  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||           ||  ||||||||||||| ||||                
5230 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgtttt 5329  T
141 ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
     |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5330 tgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 67; Significance: 2e-29; HSPs: 2)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 35170 - 35087
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
35170 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt--tagtttttggtccctgc 35087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 34932 - 34988
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
34932 gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt 34988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 62; Significance: 2e-26; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 2779 - 2962
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||         ||||||||||||||||||||                  
2779 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttc 2877  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||| ||| |||| ||||||||||||||| ||||||||||||  || |||| ||| | |||||||||||||||||||||    
2878 aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtagtttttggtccctgc 2962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 58; Significance: 5e-24; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3917 - 3734
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng 142  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |         ||||||||||||| ||||||                  
3917 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg-taacttttttttgtttttggtccttgcaaaattttttgtttttt 3819  T
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    |||||||||||||| | || |||||| |||||||||||||||||||||| || ||| |||  |||||||||||||||||||||||    
3818 aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtagtttttggtccctgc 3734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3533 - 3584
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
3533 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 3584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 58; Significance: 5e-24; HSPs: 3)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 8432 - 8517
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc 227  Q
    ||||||||||||||| |||| ||||||||||||||||||| ||||||||| || |||||||| |||||||| ||||||||||||||    
8432 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttggtccctgc 8517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8331 - 8382
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| ||||||||| |||||||||    
8331 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 8382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 8641 - 8590
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| ||||||||| |||||||||    
8641 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 8590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 56; Significance: 9e-23; HSPs: 3)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 94160 - 94243
Alignment:
143 aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg 226  Q
    |||||||||| ||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| ||||    
94160 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtacctg 94243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 94058 - 94112
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||    
94058 gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg 94112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta 90  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||    
94329 gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 24558 - 24475
Alignment:
142 gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct 225  Q
    |||||||||| |||| ||  || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||    
24558 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttttgtccct 24475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24373 - 24427
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||    
24373 gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg 24427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 47; Significance: 2e-17; HSPs: 3)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 54816 - 54870
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
54816 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 54870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 50023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 55124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 47; Significance: 2e-17; HSPs: 3)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 82705 - 82651
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
82705 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 82651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 82342 - 82396
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||    
82342 gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 82396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 82460 - 82509
Alignment:
159 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||||||||    
82460 ccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt 82509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 75763 - 75709
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
75763 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 75709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 75360 - 75414
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  |||||||||||||| ||||||||||||||||||||||    
75360 gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg 75414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 45; Significance: 3e-16; HSPs: 6)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 4042 - 4098
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||    
4042 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt 4098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 19224 - 19280
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||    
19224 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt 19280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 4287 - 4231
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||| ||||    
4287 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt 4231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19469 - 19413
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 99  Q
    ||||||||| ||||||| |||||||||||||| ||||||||||||||||||| ||||    
19469 gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt 19413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #5
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 4128 - 4175
Alignment:
151 ccctgaacccacttttgtgatgatttgcatacgtggcacattataact 198  Q
    |||||| ||||||| || ||||||||||||||||||||||||||||||    
4128 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 4175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #6
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 19310 - 19357
Alignment:
151 ccctgaacccacttttgtgatgatttgcatacgtggcacattataact 198  Q
    |||||| ||||||| || ||||||||||||||||||||||||||||||    
19310 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 19357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 12526 - 12577
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||    
12526 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 12577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 27363 - 27309
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
27363 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 27309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 27072 - 27114
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||| |||||||||||||||||||||||||||||| |||||||    
27072 ttttggtccctgcaaatatgcctcgttttggttttggtccctg 27114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17965 - 17911
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||    
17965 gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg 17911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 17863 - 17791
Alignment:
143 aaaatagtccctgaacccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 213  Q
    |||||||||||||| |||||| |  ||||||||||||||||||||| ||||  | |||||||  |||||||||    
17863 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag 17791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 4)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47926 - 47980
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
47926 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
45 taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    ||||||| |||||| ||||||||||||||||||| ||||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 48180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 223171 - 223120
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| ||||||||||||||| |||  ||||||||||||||    
223171 gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 223120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 222884 - 222925
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
222884 ttttggtccctgcaaatatgtctcgttttggttttggtccct 222925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 148281 - 148227
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||    
148281 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 148227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 148007 - 148050
Alignment:
160 cacttttgtgatgatttgcatacgtggcacattataactgaacc 203  Q
    |||||||||||||||||||| ||||||||||| || ||||||||    
148007 cacttttgtgatgatttgcacacgtggcacatgatgactgaacc 148050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 2659 - 2606
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| |||||||||||||||||| ||||||||||||||||||    
2659 gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct 2606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 2413 - 2463
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||||||||| || |||||||| ||||    
2413 cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4078 - 4028
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 93  Q
    |||||||||||||||| ||||||||||||||| |||||||| |||||||||    
4078 gctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc 4028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 97
Target Start/End: Original strand, 3743 - 3807
Alignment:
33 tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    |||||| || ||||||||| |||||| |||||||||||||||| | |||||||||||| ||||||    
3743 tataaaataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg 3807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 36; Significance: 0.00000000007; HSPs: 3)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 22054 - 22003
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 94  Q
    ||||||||| |||||| |||||| ||||| ||||||||||||||||||||||    
22054 gctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc 22003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 21808 - 21858
Alignment:
158 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    |||||||||||||||||||||| ||||||||| | || | |||||||||||    
21808 cccacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt 21858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 21763 - 21804
Alignment:
55 ttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
21763 ttttggtccctgcaaatatgtctcgttttggttttggtccct 21804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16725 - 16779
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| | |||| ||||||||||||||  ||||||||||||||||||||||    
16725 gctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg 16779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 16832 - 16891
Alignment:
149 gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 208  Q
    ||||||||  ||||||||||||||||||||| | ||||||||| || |||||||| ||||    
16832 gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 16891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 37124 - 37034
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc 778  Q
    ||||||||||||| |||||||||||| ||||| ||||||||| |  || |||| |||||||| ||| |||||||||||   ||||||||||    
37124 agacgaacagagaccggtgaaactgataatacaaacaaaagacgctgtatataggcggaacatccgaaaataaacaccataaaaaacaccc 37034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 3454 - 3405
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 92  Q
    |||||||||  |||||||| |||||||||||| |||||||||||||||||    
3454 gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 34; Significance: 0.000000001; HSPs: 3)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 2502 - 2555
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| ||||||  ||||||||||||||| |||||||| |||||||||||    
2502 gctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct 2555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 2882 - 2829
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct 96  Q
    ||||||||| |||||| ||||||||||||||| |||||||||  ||||||||||    
2882 gctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct 2829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 2615 - 2664
Alignment:
153 ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac 202  Q
    |||| |||||||||||||| ||||||| ||||||||||| || |||||||    
2615 ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac 2664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35083 - 35029
Alignment:
43 gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg 97  Q
    ||||||||| ||||||  ||| | |||||||| ||||||||||||||||||||||    
35083 gctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg 35029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1613 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold1613
Description:

Target: scaffold1613; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 765
Target Start/End: Original strand, 659 - 736
Alignment:
689 agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacc 765  Q
    ||||||||| ||||| ||||  | |||||||| ||| ||||| ||||| |||||| |||||||||| |||||||||||    
659 agacgaacaaagatccgtgattcagagaatacaaactaaagacgtcgtatatatgtggaacacccgaaaataaacacc 736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University