View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4841-Insertion-2 (Length: 786)
Name: NF4841-Insertion-2
Description: NF4841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4841-Insertion-2 |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (3 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0123 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (3 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (3 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (6 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold1613 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 210)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 323 - 625
Target Start/End: Original strand, 7194609 - 7194912
Alignment:
| Q |
323 |
taaactatatagtataatttaaatttggatattttactaataacaataagaaactgcaggttctctgcattcgaagacatatattaaacaaaattgtttg |
422 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7194609 |
taaactatatagtatatttaaaatttggatattttactaataacaataagaaactgcagttgctctgcattcgaagacatatattaaacaaaattgtttg |
7194708 |
T |
 |
| Q |
423 |
aacttaattatcgaacgtcgtgtgtgcattgtttacgtttattatttcnnnnnnn-atacttttgaactgagttgttgttcttactatactcctatttaa |
521 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7194709 |
aacttaattatcgaacatcgtgtgtgcattgtttacgtttattatttcttttttttatacttttgaactgagttgttgttcttactatactcctatttaa |
7194808 |
T |
 |
| Q |
522 |
gttctttaacacatggtagaatacaataatttcaaaggatagaaatttggttctacaacttttttgacaattatggtattctatcccatgtgaaataaat |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
7194809 |
gttctttaacacatggtagaatacaataatttcaaaggatagaaatttggttctacaacttttttgacaattatggtattctaccccatgtaaaataaat |
7194908 |
T |
 |
| Q |
622 |
aaat |
625 |
Q |
| |
|
|||| |
|
|
| T |
7194909 |
aaat |
7194912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 18633960 - 18633774
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
18633861 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18633860 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
18633774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 28550828 - 28551012
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| | |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
28550927 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550928 |
aaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttggtccctgc |
28551012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35166157 - 35165973
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||| |||||||||||||||||||||||| || ||||||||||||||||| | |
|
|
| T |
35166157 |
gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaaaaaaaattatttttggtccctgcaaaattttttgtttttg |
35166058 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35166057 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
35165973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 36577723 - 36577906
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | |||||||||| ||||||||| | |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggcccctgcaaaattttttgtttttg |
36577821 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36577822 |
aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
36577906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 6118498 - 6118308
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn------ttgtttttggtccctgcaaacnnnnnnn |
136 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
6118399 |
T |
 |
| Q |
137 |
nnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6118398 |
tttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
6118308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29172524 - 29172710
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt |
29172623 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29172624 |
tgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttcgtccctgc |
29172710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35167164 - 35166979
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaatttgtttttggtccttgcaaaaatttttgttttt |
35167065 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167064 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
35166979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 2217853 - 2217671
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| | |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgtaaa--attttgtttttg |
2217756 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2217755 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttggtccctgc |
2217671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29875401 - 29875586
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
29875401 |
gctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaatttttttgttttt |
29875500 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29875501 |
gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttggtccctgc |
29875586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29693089 - 29692906
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||||||||||||| || | ||||||||||||||| |||| | |
|
|
| T |
29693089 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttg-taaaaaaaaattgtttttggtccctacaaaattttttgtttttg |
29692991 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29692990 |
aaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
29692906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 30800849 - 30800665
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattttttttttgtttttggtccctgcaaaattttttgtttttg |
30800750 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30800749 |
aaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaattttgaagtttttggtccctgc |
30800665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 42207243 - 42207427
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| || ||||||| |||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
42207342 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42207343 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgatccctgc |
42207427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 5614529 - 5614347
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt |
5614430 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5614429 |
tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
5614347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 15635379 - 15635558
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnt-tgtttttggtccctgcaaacnnnnnnnnnnnnga |
143 |
Q |
| |
|
||||||| ||||||||||| |||||||||| || ||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataatgtttttggtccctgcaaaattttttgtttttga |
15635478 |
T |
 |
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15635479 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
15635558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29151517 - 29151703
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||| ||| |
|
|
| T |
29151517 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttttgtttt |
29151616 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151617 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
29151703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 30888161 - 30888347
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttgtttt |
30888260 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888261 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtagtttttggtccctgc |
30888347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 5950177 - 5950359
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaaatgtttttggtccctgcaaaattttttgtttttg |
5950274 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
5950275 |
aaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtagtttttggtctctgc |
5950359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16616463 - 16616548
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16616463 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
16616548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 27850275 - 27850190
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27850275 |
gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
27850190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 38962992 - 38962907
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38962992 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
38962907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 294091 - 294006
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
294091 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
294006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 21050576 - 21050760
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||| |||||||| |||||||||||| |||||||||||||||||||| | |
|
|
| T |
21050576 |
gctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
21050675 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21050676 |
aaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtctctgc |
21050760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38786160 - 38786343
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
38786259 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| | || ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786260 |
aaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacc-attttgtagtttttggtccctgc |
38786343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 16038738 - 16038553
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
16038639 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16038638 |
gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
16038553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 10408929 - 10409117
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaaaaattgtttttgatccctgcaaaattttttgt |
10409028 |
T |
 |
| Q |
138 |
nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10409029 |
ttttgaaaatagtccctga-cccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtctctgc |
10409117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7075860 - 7075775
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7075860 |
gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc |
7075775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 223
Target Start/End: Complemental strand, 23382208 - 23382127
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23382208 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc |
23382127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 25779060 - 25778975
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttatagtttttggtccctgc |
25778975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 31037497 - 31037582
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
31037582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 38496521 - 38496606
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
38496606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 144 - 227
Target Start/End: Complemental strand, 21125170 - 21125087
Alignment:
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21125170 |
aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc |
21125087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 33336025 - 33335838
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtcgctgcaaaattttttgttt |
33335926 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33335925 |
ttgaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaatcaattttgtagtttttggtccctgc |
33335838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 37090640 - 37090555
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttggtctctgc |
37090555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 39379330 - 39379411
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||| || ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379330 |
gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtcc |
39379411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 43 - 225
Target Start/End: Original strand, 4203457 - 4203637
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||| | |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgccta--taaaaaaaattgtttttggtctgtgcaaaatttcttgtttttg |
4203554 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
4203555 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaattttgtaatttttggtccct |
4203637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 25561706 - 25561894
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
25561805 |
T |
 |
| Q |
141 |
ngaaaata-gtccctgaacccac-ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| ||| |||| ||||| ||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25561806 |
tgaaaataagtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaataaattttgtagtttttggtccctgc |
25561894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 18046250 - 18046165
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
18046250 |
gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaattttatagttcttggtccctgc |
18046165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 34125308 - 34125491
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttt |
34125407 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| |||| |||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
34125408 |
aaaatagtctctga-cccatttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
34125491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 3850525 - 3850441
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
3850525 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
3850441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 10744053 - 10743873
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccctacaaatttttttgtttttt |
10743954 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||| ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
10743953 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtagtttttggtcc |
10743873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 27916564 - 27916648
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||| || || || |||||||||||||||||||||||||||||||| |
|
|
| T |
27916564 |
aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtagtttttggtccctgc |
27916648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 43 - 219
Target Start/End: Complemental strand, 28863837 - 28863656
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn |
137 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaattttttgt |
28863738 |
T |
 |
| Q |
138 |
nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| |
|
|
| T |
28863737 |
tttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtagtttttg |
28863656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 146 - 227
Target Start/End: Complemental strand, 3850719 - 3850638
Alignment:
| Q |
146 |
atagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||| |||| |||| || |||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
3850719 |
atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
3850638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14318300 - 14318215
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
14318300 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgatccctgc |
14318215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 18633600 - 18633656
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29172885 - 29172829
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29875724 - 29875668
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13990894 - 13990843
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 24782175 - 24782092
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||| |||| || || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
24782175 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttttgtccct |
24782092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2217495 - 2217549
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7075573 - 7075627
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28863511 - 28863565
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29692745 - 29692799
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30800495 - 30800549
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36578082 - 36578028
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40029496 - 40029442
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9179919 - 9179736
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttgtttttt- |
9179821 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| | || |||| | |||||||||||||| |||||||||||| ||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
9179820 |
aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacctattttatagtttttggtccctgc |
9179736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 13990708 - 13990792
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| || | ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||| |||||||| |
|
|
| T |
13990708 |
aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtagtttttagtccctgc |
13990792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 15635706 - 15635650
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 142 - 218
Target Start/End: Original strand, 40029240 - 40029316
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
218 |
Q |
| |
|
||||||||||||| | ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40029240 |
gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaattttgtagttttt |
40029316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10743725 - 10743776
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 16038378 - 16038429
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18046347 - 18046296
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1105147 - 1105093
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1381610 - 1381556
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5917459 - 5917405
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6912498 - 6912552
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11799457 - 11799403
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19565830 - 19565776
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19685379 - 19685325
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24443743 - 24443689
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26133184 - 26133238
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26133412 - 26133358
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35928065 - 35928119
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 38170515 - 38170569
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40167787 - 40167841
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40764416 - 40764470
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 2636994 - 2636941
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2636994 |
aagctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 10409325 - 10409269
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggt |
10409269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 25561998 - 25561942
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggt |
25561942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 29151850 - 29151794
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29151850 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 38496781 - 38496725
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38496781 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 39379609 - 39379553
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt |
39379553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 293829 - 293880
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 20660949 - 20661000
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 23382296 - 23382245
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45139 - 45193
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1104859 - 1104913
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1104859 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1381248 - 1381302
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4203769 - 4203715
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5917127 - 5917181
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5917127 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11799130 - 11799184
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11799130 |
gctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18046039 - 18046093
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19565468 - 19565522
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19685018 - 19685072
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20986088 - 20986034
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20986088 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21050912 - 21050858
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
21050912 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21124914 - 21124968
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24443381 - 24443435
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24443381 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24781990 - 24782044
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 25992418 - 25992329
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccga-aataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||| |||||||| | ||| |||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
25992418 |
agacgaacagagaccggtgaaaatgataatacaaacaaaaggcgccgtatatatgcggaacacccgacaataaaca-ccctaaaaacaccc |
25992329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29366948 - 29366894
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34125631 - 34125577
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35876689 - 35876743
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35876689 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35928457 - 35928403
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37271360 - 37271414
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37271360 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40764779 - 40764725
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764779 |
gctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 29366847 - 29366763
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||| |||||||| ||||| || | |||||| ||||| ||||||||||| ||||| |
|
|
| T |
29366847 |
aaaataatccctgaccccatttttgtgatgatttacatacgtgacacatgatgattgaacctattttatagtttttggttcctgc |
29366763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 35166912 - 35166960
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag |
91 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 2032939 - 2032888
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||| || |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3850300 - 3850355
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttgg-ttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
3850300 |
gctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg |
3850355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 5614167 - 5614218
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
5614167 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 97
Target Start/End: Original strand, 12144899 - 12144962
Alignment:
| Q |
34 |
ataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| || ||||||||| |||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12144899 |
ataaaataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14318046 - 14318097
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18258526 - 18258475
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28213374 - 28213425
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28213374 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 31602265 - 31602320
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| |||||| ||||||||| |
|
|
| T |
31602265 |
cccacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag |
31602320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1286683 - 1286737
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||| || |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1286683 |
gctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4736541 - 4736487
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9179594 - 9179648
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18258163 - 18258217
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18258163 |
gctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20661310 - 20661256
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
20661310 |
gctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20683748 - 20683802
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
20683748 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20690734 - 20690784
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 22551214 - 22551144
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||| |||| || ||||||| ||||||||| |
|
|
| T |
22551214 |
aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag |
22551144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23381951 - 23382005
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
23381951 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25779161 - 25779107
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 26405212 - 26405301
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||||||| ||||| |||| ||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
26405212 |
agacgaacaaagaccggtgaaactgagaatacaaacaaaaggcgtcgtatatagtcggaacacccgaaaataaaca-ccttaaaaacaccc |
26405301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28871993 - 28871939
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| || |||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28871993 |
gctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35609304 - 35609358
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35877051 - 35876997
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
35876997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37271705 - 37271651
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40029142 - 40029196
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg |
40029196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40168007 - 40167953
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 9532307 - 9532376
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| | || ||||| |||||||||||||| |||||||| |
|
|
| T |
9532307 |
cccatttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtagtttttagtccctgc |
9532376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 18286740 - 18286691
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18286740 |
gctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 38962807 - 38962856
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 96
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 53 - 99
Target Start/End: Original strand, 6118143 - 6118190
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgtttt-ggttttagtccctggt |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6118143 |
ggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt |
6118190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| |||||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 42994069 - 42994116
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42994069 |
gctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 2636670 - 2636720
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
2636670 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3851328 - 3851274
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
3851328 |
gctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5904009 - 5904063
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
5904009 |
gctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 17070646 - 17070708
Alignment:
| Q |
151 |
ccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||| || | |||| | ||||||||| |
|
|
| T |
17070646 |
ccctgaccccacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtag |
17070708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17070862 - 17070808
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||||||| ||||||| ||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg |
17070808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
20690840 |
gtccctgaccccacttttgtgatgatttgcatacatggcacat |
20690882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36973709 - 36973655
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40038857 - 40038803
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
40038857 |
gctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42553643 - 42553693
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 689 - 777
Target Start/End: Original strand, 7194965 - 7195053
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaaca-cccgaaataaacacccctaaaaacacc |
777 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||| ||||||||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
7194965 |
agacgaacaaagatcgatgaaactgagaatatagacaaaatgagtcgtttatatgcggaacatccaaaaataaaca-ccctaaaaacacc |
7195053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 15916287 - 15916340
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| | |||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
15916287 |
gctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |||| |||||| || |||||||| |||| |
|
|
| T |
26071397 |
tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
26071458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc |
31037446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 32108926 - 32108975
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
32108926 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
32108975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 38555082 - 38555030
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38555082 |
gctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 40038614 - 40038663
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
40038614 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt |
40038663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 703 - 755
Target Start/End: Original strand, 4914177 - 4914229
Alignment:
| Q |
703 |
cggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccga |
755 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||||| |||| |
|
|
| T |
4914177 |
cggtgaaactgagaatactaattaaaggtgtcgtatatatgcggaacatccga |
4914229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 5904253 - 5904205
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||||| |||| |
|
|
| T |
5904253 |
cacttttgtgatgatttgcatacgtgacatatgataactgaacccattt |
5904205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 11799205 - 11799286
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| || |||||||||||||| |||| ||||| |||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
11799205 |
gaaaatagtccttggccccacttttgtgataattt----acgtgacacattttaaaagaaccaattttgtagtttttggtctctgc |
11799286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 20416361 - 20416413
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||| |||||||| |||||| |
|
|
| T |
20416361 |
gctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 26071597 - 26071561
Alignment:
| Q |
61 |
tccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26071597 |
tccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||| |||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 1105075 - 1105032
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
1105032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 4736433 - 4736374
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||| |||| ||||||||||| || |||||||| |||| |
|
|
| T |
4736433 |
gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt |
4736374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 9588598 - 9588559
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9588598 |
ttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 10830638 - 10830697
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |||| || |||||||| |||| |
|
|
| T |
10830638 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt |
10830697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 11935861 - 11935802
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||| |||||| |||| |||||| ||||||||| |
|
|
| T |
11935861 |
gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaattt |
11935802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 28107918 - 28107961
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
28107918 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
28107961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 28213446 - 28213489
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctgg |
28213489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 28871711 - 28871754
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgg |
28871754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 97
Target Start/End: Original strand, 29855613 - 29855668
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||| | |||| |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
29855613 |
agctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 32108796 - 32108863
Alignment:
| Q |
30 |
ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| || ||||||||| |||||| ||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
32108796 |
ttatataatttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 204
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
37271597 |
gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
37271542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 40038495 - 40038542
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
40038495 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 1286974 - 1286932
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1286932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10830530 - 10830584
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| || ||||||||||| |||||||||||||| |||| |
|
|
| T |
10830530 |
gctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 98
Target Start/End: Complemental strand, 12145181 - 12145127
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||| |||| ||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg |
12145127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17070536 - 17070589
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
17070536 |
gctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 95
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||| ||||| |||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
20661057 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacat |
20661099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26071292 - 26071346
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26071292 |
gctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | | ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 28213491 - 28213541
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
28213491 |
cccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
28213541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 32888798 - 32888848
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
| T |
32888798 |
cccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
32888848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 2636788 - 2636837
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
| T |
2636788 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
2636837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 5104000 - 5103951
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||| ||||||||||||| |
|
|
| T |
5104000 |
gctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9588493 - 9588444
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| || |||||||| |||| |
|
|
| T |
9588493 |
ccacttttgtgataatttacatacgtggcacatgatgactgaacccattt |
9588444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||| ||||||||| |||||||||||| || |||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 19685135 - 19685180
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
19685135 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
19685180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| | |||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 24443499 - 24443544
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
24443499 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
24443544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35609392 - 35609441
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
35609392 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
35609441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 36973354 - 36973403
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
36973354 |
gctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 103; Significance: 8e-51; HSPs: 180)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 33801742 - 33801557
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaatttttttgttttt |
33801643 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33801642 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
33801557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 41 - 222
Target Start/End: Original strand, 31166869 - 31167051
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31166869 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccctgcaaaattttttgttt |
31166968 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166969 |
ttgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
31167051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 15076203 - 15076018
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
15076104 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15076103 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
15076018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8680776 - 8680962
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
8680875 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8680876 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc |
8680962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 7155798 - 7155983
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
7155897 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155898 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
7155983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 34582530 - 34582715
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttttgtttt |
34582629 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34582630 |
tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctg |
34582715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32885674 - 32885859
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
32885773 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32885774 |
gaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
32885859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14655669 - 14655584
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
14655584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 24273939 - 24274024
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
24274024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 15962028 - 15962214
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
15962127 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15962128 |
tggaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttggtccctgc |
15962214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 219
Target Start/End: Complemental strand, 30929043 - 30928867
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| | |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttttg |
30928944 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
30928943 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttg |
30928867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 494753 - 494576
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
494753 |
aagctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaaaaaaaaaattgtttttagtccctgcaaa---------att |
494663 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
494662 |
tgaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc |
494576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 543723 - 543538
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| | |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
543723 |
gctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaattttttatttt |
543624 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
543623 |
tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttggtccctg |
543538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 37 - 227
Target Start/End: Complemental strand, 24692984 - 24692795
Alignment:
| Q |
37 |
aactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnn |
136 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
24692984 |
aactaggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgc-aaaaaaaaattgtttttggtctctgcaaaattttttg |
24692886 |
T |
 |
| Q |
137 |
nnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
24692885 |
tttttgaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtagtttttggtctctgc |
24692795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 317813 - 317995
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg--taaaaaaaattgtttttggtccctgcaaatttttttgtttttt |
317910 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317911 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
317995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 2616134 - 2616049
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616134 |
gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
2616049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 15116773 - 15116858
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116773 |
gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
15116858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17321453 - 17321368
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttggtccctgc |
17321368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17321586 - 17321501
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttggtccctgc |
17321501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 10091039 - 10091220
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||| ||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
10091137 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
10091138 |
aatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgttccctgc |
10091220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 777939 - 777853
Alignment:
| Q |
142 |
gaaaatagtccc-tgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
777939 |
gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
777853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 1890062 - 1890246
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
1890161 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1890162 |
aaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttggtccctgc |
1890246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 45 - 227
Target Start/End: Complemental strand, 3356495 - 3356315
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcccta--taaaaaaaattgtttttggtccctggaaaattttttgtttttgaa |
3356398 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| |||| |||||||||||| | ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3356397 |
aatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaattttgtcgtttttggtccctgc |
3356315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 7324091 - 7324007
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7324091 |
aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaattttgtagtttttgatccctgc |
7324007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 220
Target Start/End: Complemental strand, 19296305 - 19296227
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19296305 |
gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtagtttttgg |
19296227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 11129302 - 11129387
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaattttttagtttttgatccctgc |
11129387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26375694 - 26375878
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaattgtttttgttccctgcaaaattttttgtttttt |
26375793 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26375794 |
aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttggtccctgc |
26375878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 6468570 - 6468486
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
6468570 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtagtttttggtccctgc |
6468486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 19275939 - 19275855
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19275939 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc |
19275855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 21995167 - 21995251
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
21995167 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc |
21995251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 31398440 - 31398370
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta |
31398370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 6591339 - 6591255
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
6591339 |
aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgatccctgc |
6591255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 40 - 210
Target Start/End: Original strand, 14428648 - 14428818
Alignment:
| Q |
40 |
taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14428648 |
taagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgttt |
14428747 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
210 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
14428748 |
tttaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg |
14428818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 5286687 - 5286775
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggc---acattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5286687 |
gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaattttgtagtttttggtccctgc |
5286775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 2373391 - 2373307
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| | |||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
2373391 |
aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc |
2373307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 7156159 - 7156103
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 12612236 - 12612172
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
12612236 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
12612172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 24274130 - 24274074
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 33131626 - 33131710
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | || | ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
33131626 |
aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtagtttttggtccctgc |
33131710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15962388 - 15962334
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1890451 - 1890395
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 8681115 - 8681059
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 12419937 - 12419881
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 14655380 - 14655436
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 22822650 - 22822594
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 23770400 - 23770336
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||||||||| |
|
|
| T |
23770400 |
ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttggtccctgc |
23770336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 25431863 - 25431799
Alignment:
| Q |
33 |
tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25431863 |
tataaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 494406 - 494457
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 44 - 99
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 176 - 227
Target Start/End: Original strand, 22822391 - 22822442
Alignment:
| Q |
176 |
tgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22822391 |
tgcaaacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
22822442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1007508 - 1007454
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3414388 - 3414442
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3969008 - 3968954
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19296406 - 19296352
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21994402 - 21994348
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21995065 - 21995119
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22543355 - 22543409
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25137356 - 25137302
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30928682 - 30928736
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34582891 - 34582837
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 2615873 - 2615926
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 7324189 - 7324137
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 9896537 - 9896453
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| | || |||| |||| ||||||||||||||||||||| || || |||||||| |||||||||||||||||| |||| |
|
|
| T |
9896537 |
aaaatagtcaccgatcccatttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtagtttttggtctctgc |
9896453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 161 - 226
Target Start/End: Original strand, 11448657 - 11448726
Alignment:
| Q |
161 |
acttttgtgatgatttgcatacgt----ggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11448657 |
acttttgtgatgatttgcatacgtacgtgacacattataactgaatcaattttgtagtttttggtccctg |
11448726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 22792898 - 22792846
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 31167199 - 31167143
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 33808621 - 33808677
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3356143 - 3356194
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 12419709 - 12419760
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12419709 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 17771912 - 17771963
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1007125 - 1007179
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1007125 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2373180 - 2373234
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3968646 - 3968700
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6412219 - 6412273
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6412219 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6412578 - 6412524
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6412578 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6468311 - 6468365
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6468311 |
gctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10910963 - 10910909
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11449168 - 11449114
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12299139 - 12299085
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12612358 - 12612304
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12612358 |
gctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg |
12612304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19690394 - 19690448
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20467717 - 20467663
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21147405 - 21147459
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21147405 |
gctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21385252 - 21385306
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21385583 - 21385529
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21385583 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21995424 - 21995370
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22543717 - 22543663
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23502539 - 23502485
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25136995 - 25137049
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25136995 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 30479438 - 30479367
Alignment:
| Q |
24 |
atgttcttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| ||| ||||||||||| |||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
30479438 |
atgttcttataaaaa--aagctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31198616 - 31198670
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33131849 - 33131795
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 13268110 - 13268163
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13268110 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 19321130 - 19321081
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 25431672 - 25431721
Alignment:
| Q |
174 |
tttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25431672 |
tttgcatacgtgacacattataactaaaccaattttgtagtttttggtcc |
25431721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 777678 - 777734
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| | ||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
777678 |
gctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt |
777734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 11448538 - 11448590
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 33808837 - 33808797
Alignment:
| Q |
187 |
cacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808837 |
cacattataactgaaccaattttgtagtttttggtccctgc |
33808797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 34989961 - 34990013
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34989961 |
agctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3276353 - 3276302
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3276353 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 9896636 - 9896585
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
| Q |
54 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 19129337 - 19129392
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| |||| || ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19129337 |
gctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg |
19129392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 318096 - 318042
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
318096 |
gctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 2616239 - 2616193
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2616239 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3414751 - 3414697
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 6591116 - 6591162
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6591116 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 8170150 - 8170100
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 12757611 - 12757661
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
12757611 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14656259 - 14656205
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14656259 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18024374 - 18024320
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19267566 - 19267620
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19296109 - 19296163
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19296109 |
gctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21993788 - 21993842
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 23502238 - 23502284
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23502238 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 24901240 - 24901290
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31186590 - 31186536
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31186590 |
gctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 778041 - 777992
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
778041 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 13617648 - 13617697
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
13617648 |
ccacttttgtgatgatttgcacacgtggcacatgataactgaacccattt |
13617697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 17765010 - 17765059
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 22822308 - 22822357
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22822308 |
gctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 30239294 - 30239347
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| | ||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
30239294 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcaca |
190 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17772014 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca |
17772062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 689 - 729
Target Start/End: Original strand, 20701461 - 20701501
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaag |
729 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20701461 |
agacgaacagagatcggtgaaactgagaatacaaacaaaag |
20701501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 83
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgtttt |
83 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23770438 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 31276341 - 31276285
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
31276341 |
aagctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 34990213 - 34990129
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||| || |||||||| || | ||||| |||| ||||||||||||||||| |
|
|
| T |
34990213 |
aaaatagtccttgatcccatttttgtgatgatttgcaaacatggcacatgatgattgaactgatttattagtttttggtccctgc |
34990129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 24901347 - 24901406
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||| |||| |
|
|
| T |
24901347 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacccattt |
24901406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 31398540 - 31398489
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10910630 - 10910684
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
10910630 |
gctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 11129542 - 11129496
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11129542 |
gctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13150749 - 13150695
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13150749 |
gctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19129519 - 19129465
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19129519 |
gctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 19276050 - 19275984
Alignment:
| Q |
31 |
tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| |||| | ||||||| |||||||||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
19276050 |
tatatatactaggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctg |
19275984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25121495 - 25121441
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25121495 |
gctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 1214995 - 1214942
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1214995 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg |
9896333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 15442938 - 15442987
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
15442938 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 19320886 - 19320935
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
19320886 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
19320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 31198734 - 31198783
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
31198734 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
31198783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 689 - 776
Target Start/End: Original strand, 3880276 - 3880363
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc-cgaaataaacacccctaaaaacac |
776 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||| | ||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
3880276 |
agacgaacagagaccggtgaaactgaaaatacaaacaaaaggttccgtatataagcggaacaccaaaaaataaaca-ccctaaaaacac |
3880363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 6564933 - 6564893
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
6564933 |
ggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctggt |
19275179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 23628797 - 23628849
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23628797 |
aagctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 1007197 - 1007240
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
1007240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 1214767 - 1214810
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctgg |
1214810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 12298927 - 12298986
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
12298927 |
gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
12298986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 78
Target Start/End: Complemental strand, 15117039 - 15117004
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctc |
78 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15117039 |
gctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 25137066 - 25137109
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
25137109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 31185753 - 31185796
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
31185753 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
31185796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 31198688 - 31198731
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
31198731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1875503 - 1875557
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
1875503 |
gctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg |
1875557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14655904 - 14655958
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14655904 |
gctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg |
14655958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 15116674 - 15116721
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15116674 |
gctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15722611 - 15722665
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17765374 - 17765320
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
17765374 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 23629044 - 23628994
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
| T |
23629044 |
cccacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt |
23628994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 1214697 - 1214750
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
1214697 |
gctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 3968764 - 3968809
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
3968764 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
3968809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 99
Target Start/End: Original strand, 5286606 - 5286643
Alignment:
| Q |
62 |
ccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtccttggt |
5286643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 12611996 - 12612045
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
12611996 |
gctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt |
12612045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 13268218 - 13268255
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtgg |
186 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
13268218 |
gtccctgaccccacttttgtgatgatttgcacacgtgg |
13268255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 103; Significance: 8e-51; HSPs: 217)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 38980252 - 38980067
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
38980153 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38980152 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
38980067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 37272101 - 37271916
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
37272002 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37272001 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
37271916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 26814228 - 26814042
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaattttttgtttt |
26814129 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26814128 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
26814042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19183783 - 19183969
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaattttttgtttt |
19183882 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19183883 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
19183969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 23989839 - 23990022
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||| | |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcacta-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
23989937 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989938 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
23990022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 3838266 - 3838077
Alignment:
| Q |
40 |
taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnn |
137 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3838266 |
taagctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgt |
3838167 |
T |
 |
| Q |
138 |
nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3838166 |
ttttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
3838077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38731830 - 38732013
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
38731928 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38731929 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggttcctgc |
38732013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 24483632 - 24483717
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483632 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
24483717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 44985623 - 44985807
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| | |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaatttgtttttggtccatgcaaaaatttttgtttttg |
44985722 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44985723 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtagtttttggtccctgc |
44985807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 11713844 - 11713658
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttgtttt |
11713745 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11713744 |
tgaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaattttgtagtttttggtccctgc |
11713658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 26707863 - 26708057
Alignment:
| Q |
32 |
atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn |
131 |
Q |
| |
|
||||||| || ||||||||| ||||||| ||||||||||||| | ||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
26707863 |
atataaaataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaatt |
26707961 |
T |
 |
| Q |
132 |
nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26707962 |
tgttgtttttgaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttggtctctgc |
26708057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 40301976 - 40302162
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttgtttt |
40302075 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40302076 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtagtttttggtccctgc |
40302162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 43789191 - 43789005
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
43789092 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
43789091 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtagtttttggtctctgc |
43789005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 24483399 - 24483584
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
24483399 |
aagctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
24483497 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483498 |
taaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtagtttttggtccctgc |
24483584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 17541775 - 17541590
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
17541676 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17541675 |
taaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
17541590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 33732863 - 33733041
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| | |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttgatccctgcaaaattttttgtttttg |
33732960 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||| ||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33732961 |
aaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
33733041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 7814736 - 7814553
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||| ||||| | |
|
|
| T |
7814736 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg-tcaaaaaaaattgtttttggtccccgcaaaattttttgtttttg |
7814638 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7814637 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttgatccctgc |
7814553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 44073806 - 44073620
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
44073707 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
44073706 |
tgaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttggtccctgc |
44073620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 224
Target Start/End: Original strand, 20658062 - 20658242
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||| ||||||||||||||||||| | |||||||| ||||||||||| | |
|
|
| T |
20658062 |
gctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg-taaaaaaaaattgtttttagtccctgcaaaattttttgtttttg |
20658160 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
|||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20658161 |
aaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
20658242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 8046430 - 8046515
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046430 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
8046515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16899996 - 16900081
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16899996 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttggtccctgc |
16900081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16993387 - 16993472
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16993387 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttggtccctgc |
16993472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 43710480 - 43710565
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43710480 |
gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttggtccctgc |
43710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 5790898 - 5790714
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaattgtttttggtccctgcaaaaaaattttgtttt |
5790799 |
T |
 |
| Q |
142 |
-gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5790798 |
tgaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt--tagtttttggtccctgc |
5790714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 60 - 227
Target Start/End: Complemental strand, 22881950 - 22881784
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtccctgaacc |
159 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||| | || |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctaaccc |
22881852 |
T |
 |
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22881851 |
cacttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtagtttttggtccctgc |
22881784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7814505 - 7814420
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttgatccctgc |
7814420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 40786561 - 40786646
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40786561 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc |
40786646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 41693901 - 41693816
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
41693901 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaattttttagtttttggtccctgc |
41693816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 43597498 - 43597315
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||| |||||| |||||||||||||||||||||| | |||||||||||||||||||| | |
|
|
| T |
43597498 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
43597400 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
43597399 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc |
43597315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 26238816 - 26238994
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |||||||||||| | |||| ||||||||||||||| ||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg-taaaaaaaaattgtgtttggtccctgcaaatttttttgtttttgaa |
26238914 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa-ttttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
26238915 |
aatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttttgtagtttttggtcc |
26238994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 41791119 - 41791203
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41791119 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaattaattttgtagtttttggtccctg |
41791203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 1497943 - 1497758
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttgttttt |
1497844 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1497843 |
gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttttagtttttggtccctgc |
1497758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 10664985 - 10665165
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| | |||||||||| ||||||||||||| |||||| | |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
10665084 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10665085 |
aaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtagtttttggtcc |
10665165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14393029 - 14392944
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtagtttttggtctctgc |
14392944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 142 - 224
Target Start/End: Original strand, 31225817 - 31225898
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225817 |
gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaattttgtagtttttggtccc |
31225898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 12835427 - 12835511
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
12835427 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaattttata-tttttggtccctgc |
12835511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 17912452 - 17912636
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnnga |
143 |
Q |
| |
|
||||||| | |||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| || |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga |
17912551 |
T |
 |
| Q |
144 |
aaatagtccctgaacccacttttgtgat-gatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| |||||||||||||| || ||||||||| | |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17912552 |
aaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaattttgtagtttttaatccctgc |
17912636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 25954325 - 25954240
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25954325 |
gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtagtttttggttcctgc |
25954240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29865510 - 29865326
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaatttgtttttggtccctgcaaaattttttgtttttg |
29865411 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29865410 |
aaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaattttatagtttttggtccctgc |
29865326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32691314 - 32691498
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| |||||| | |
|
|
| T |
32691314 |
gctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaaattgtttttggtccttgcaaatttttttgtttttg |
32691413 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||| |||||||| |||| ||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||||||||| |
|
|
| T |
32691414 |
aaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttggtccctgc |
32691498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 45442415 - 45442499
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45442415 |
aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
45442499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 19831694 - 19831609
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19831694 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttggtccctgc |
19831609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 43592146 - 43592231
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
43592146 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtagtttttggtccctgc |
43592231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 10375068 - 10374891
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||| | |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg---taaaaaaaatgtttttggtccctgcaaaatttgttgtttttg |
10374972 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggc-acattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10374971 |
aaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaattttgtagtttttggtccctgc |
10374891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 16900205 - 16900149
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 16993596 - 16993540
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19184150 - 19184094
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 37271740 - 37271796
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24483890 - 24483836
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 5790559 - 5790615
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 17541383 - 17541439
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 26813867 - 26813923
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 31326149 - 31326066
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||| || ||||||||||||||||||||||| |
|
|
| T |
31326149 |
aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtagtttttggtccctgc |
31326066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 43788859 - 43788915
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
43788915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 22881614 - 22881665
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2481556 - 2481502
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 3671187 - 3671137
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4423896 - 4423950
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5334752 - 5334806
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5335039 - 5334985
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8046330 - 8046384
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8046647 - 8046593
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9195205 - 9195151
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11713486 - 11713540
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11788415 - 11788361
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14003741 - 14003687
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15842822 - 15842768
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16522992 - 16523046
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16523324 - 16523270
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20131680 - 20131626
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24358617 - 24358671
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25705448 - 25705394
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29859871 - 29859817
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 36622251 - 36622305
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 128
Target Start/End: Original strand, 38639413 - 38639498
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaattgtttttggtccctgcaaa |
38639498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40302338 - 40302284
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41694002 - 41693948
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43592047 - 43592101
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43597155 - 43597209
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 27311068 - 27311015
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 33733240 - 33733187
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 7814247 - 7814303
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 10671940 - 10671889
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 13215056 - 13215115
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13215056 |
actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1497611 - 1497665
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3671004 - 3671058
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4424184 - 4424130
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9195055 - 9195109
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12835326 - 12835380
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14003410 - 14003464
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14003410 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16673770 - 16673716
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16673770 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 17912808 - 17912754
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggt |
17912754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18113090 - 18113144
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18113090 |
gctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20131318 - 20131372
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24358944 - 24358890
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358944 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25705086 - 25705140
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26239159 - 26239105
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27310877 - 27310930
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg |
27310930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30215423 - 30215477
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30215423 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31226076 - 31226022
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg |
31226022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33576116 - 33576062
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33576116 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 34317799 - 34317853
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34317799 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41451838 - 41451892
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41693675 - 41693729
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44559063 - 44559117
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44559063 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44985983 - 44985929
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 27109074 - 27109127
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27109074 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 42695869 - 42695922
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 42696204 - 42696151
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42696204 |
aagctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 44993957 - 44993881
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || || |||| |||| |||||||||| |
|
|
| T |
44993957 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtagtttttg |
44993881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 4042611 - 4042662
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4042611 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 36806892 - 36806841
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 146689 - 146635
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2265396 - 2265342
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
2265396 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3837934 - 3837988
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4794131 - 4794185
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10671631 - 10671685
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 13337667 - 13337578
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| |||||||| ||||| |||| | |||||||| | ||||||||| |||||||||||||| |
|
|
| T |
13337667 |
agacgaacagagaccggtgaaacagagaatacaaacaaaaggcgtcgtatataggtggaacacctgaaaataaaca-ccctaaaaacaccc |
13337578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16673412 - 16673466
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17302142 - 17302088
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31225716 - 31225770
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
31225716 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31325921 - 31325975
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31325921 |
gctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31326251 - 31326197
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31326251 |
gctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg |
31326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31644842 - 31644892
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32476096 - 32476150
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32476096 |
gctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33575753 - 33575807
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
48 |
aatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37911119 - 37911065
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
37911119 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40124967 - 40125021
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40786461 - 40786515
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
40786461 |
gctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 41791311 - 41791261
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43710707 - 43710653
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43710707 |
gctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 38979890 - 38979947
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatat-gcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38979890 |
gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 689 - 742
Target Start/End: Complemental strand, 42802503 - 42802450
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatat |
742 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
42802503 |
agacgaacagagatcagtgaaactgagaatacaaacaaaaggtgtcgtatatat |
42802450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 36622349 - 36622432
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||| || ||||| || || ||||| ||||| |||||||||||| |||| |
|
|
| T |
36622349 |
aaaatagtccatgaccccatttttgtgatgatttgcatac-tgccacatgatgacggaaccgattttatagtttttggtctctgc |
36622432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3172021 - 3172072
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3172021 |
gctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3172531 - 3172480
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3172531 |
gctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 4042889 - 4042838
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042889 |
gctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 90
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 90
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 20939216 - 20939157
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
| T |
20939216 |
gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
20939157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 23732220 - 23732161
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
23732220 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
23732161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 25954116 - 25954167
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25954116 |
gctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 34318082 - 34318031
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
34318082 |
gctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 45442695 - 45442644
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
45442695 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1138358 - 1138304
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
1138358 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2481194 - 2481248
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || | |||||||||| |||||||||||||||||||||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10665293 - 10665239
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
10665293 |
gctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18113453 - 18113399
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
18113453 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23732327 - 23732274
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
23732327 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg |
23732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30215870 - 30215816
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30215870 |
gctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 31909477 - 31909428
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31909477 |
gctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34964158 - 34964104
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36815834 - 36815780
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
36815834 |
gctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 37228734 - 37228784
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
37228734 |
gctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40125288 - 40125234
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40125288 |
gctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43671935 - 43671989
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
43671935 |
gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 44994060 - 44994010
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
44994060 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
1138091 |
gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
1138144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 4424014 - 4424063
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
4424014 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4424063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16523108 - 16523157
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
16523108 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16523157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
25750857 |
gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
25750804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 27109161 - 27109210
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
27109161 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
27109210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 98
Target Start/End: Complemental strand, 33576075 - 33576030
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
33576075 |
ggttttagtccctgcaaatatgtctcattttggttttggtccctgg |
33576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 40125085 - 40125134
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
40125085 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40125134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 43710394 - 43710435
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
43710394 |
ttttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 689 - 757
Target Start/End: Original strand, 33788289 - 33788357
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaa |
757 |
Q |
| |
|
||||||||||||| |||||| || |||||||| ||| |||| | ||| |||||||||||||||||||| |
|
|
| T |
33788289 |
agacgaacagagaccggtgataccgagaatacaaactaaaggcgccgtatatatgcggaacacccgaaa |
33788357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4423968 - 4424011
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
4424011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4794203 - 4794246
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
4794246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4842940 - 4842999
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
| T |
4842940 |
gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacccattt |
4842999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 16523062 - 16523105
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccctgg |
16523105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 23732040 - 23732091
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23732040 |
gctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 26708184 - 26708149
Alignment:
| Q |
62 |
ccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctg |
26708149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 93
Target Start/End: Original strand, 26709692 - 26709747
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||| ||||||||| | ||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
26709692 |
actaggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 31909370 - 31909311
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
31909370 |
gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
31909311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 331
Target Start/End: Original strand, 33733217 - 33733252
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaactata |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33733217 |
cagggactaaaaccatattttagccaataaaatata |
33733252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 689 - 752
Target Start/End: Complemental strand, 34230617 - 34230555
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc |
752 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| ||||||||| | ||| |||| |||||||||| |
|
|
| T |
34230617 |
agacgaacagagatcggtg-aactgcgaatacaaacaaaagacgccgtatataggcggaacacc |
34230555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 43672041 - 43672100
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
43672041 |
gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacccattt |
43672100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 45442317 - 45442364
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
45442317 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 3832389 - 3832439
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
3832389 |
cccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
3832439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 93
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||| |||||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Original strand, 5790875 - 5790905
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5790875 |
cagggactaaaaccatattttagccaataaa |
5790905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 13215364 - 13215318
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| || ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13215364 |
gctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 14393115 - 14393077
Alignment:
| Q |
56 |
tttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14393115 |
tttagttcctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 20658408 - 20658362
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
20658408 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 34317916 - 34317966
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
34317916 |
cccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
34317966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35155618 - 35155564
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
35155618 |
gctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 35686223 - 35686173
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| || |||||||| |||| |
|
|
| T |
35686223 |
cccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
35686173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37910757 - 37910811
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
37910757 |
gctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg |
37910811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 38732120 - 38732078
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
38732120 |
ttttagtcccagcaaatatggctcgttttggttttaatccctg |
38732078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 41113404 - 41113494
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||| ||||| | || |||| |||||||| ||| ||||||| |||| |||||||||| |
|
|
| T |
41113404 |
agacgaaaagagaccggtgaaactgagaatacaaactaaagacattgtatataggcggaacatccgaaaataaataccctaaaaaacaccc |
41113494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43672317 - 43672263
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
43672317 |
gctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 2481312 - 2481357
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
2481312 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
2481357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 781
Target Start/End: Complemental strand, 4975162 - 4975069
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacacccttg |
781 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| |||| ||||| |||| || ||||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
4975162 |
agacgaacagagactagtgaaactaagaatacaaactaaaggcgtcgtatataggctgaacacccgaaaataaacaccctgaaaaacatccttg |
4975069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 781
Target Start/End: Complemental strand, 4993070 - 4992977
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacacccttg |
781 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| |||| ||||| |||| || ||||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
4993070 |
agacgaacagagactagtgaaactaagaatacaaactaaaggcgtcgtatataggctgaacacccgaaaataaacaccctgaaaaacatccttg |
4992977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 10671749 - 10671798
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
10671749 |
ccacttttctgatgatttgcacacgtggcacatgatgactgaacccattt |
10671798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| | |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 41451956 - 41452001
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
41451956 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
41452001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||| |||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg |
44993858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 8e-51; HSPs: 253)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 18473273 - 18473458
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
18473372 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473373 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
18473458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 32729048 - 32728863
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
32728949 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32728948 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
32728863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 7001896 - 7001710
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtttt |
7001797 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7001796 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc |
7001710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 14007490 - 14007673
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| | |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaatttttagtttttg |
14007588 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14007589 |
aaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtagtttttggtccctgc |
14007673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 31258340 - 31258526
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtttt |
31258439 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31258440 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
31258526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 12361012 - 12361197
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagtttgtttttcgtccctgcaaaattttttgtttat |
12361111 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12361112 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
12361197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41358662 - 41358477
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggtttt |
41358563 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
41358562 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttctagtccctgc |
41358477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 3679627 - 3679810
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |||||| |||||| |||||| | |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttctggtccttgcaaaaatttttgtttttg |
3679725 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679726 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
3679810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19622656 - 19622842
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
19622755 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622756 |
tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
19622842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26061957 - 26062143
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaattttttgtttt |
26062056 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26062057 |
tgaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc |
26062143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45290458 - 45290643
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtcccagcaaaattttttgttttt |
45290557 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290558 |
taaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
45290643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 22919685 - 22919868
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| | |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
22919783 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
22919784 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
22919868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 224
Target Start/End: Complemental strand, 48956065 - 48955882
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttt |
48955966 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955965 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
48955882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 41881094 - 41881280
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgt--ttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaaatttttgtttt |
41881193 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41881194 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttggtccctgc |
41881280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 24649351 - 24649536
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctgaaaaaaaaaaatttgtttttggcccctgcaaaattttttgttttt |
24649450 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649451 |
taaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
24649536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13259989 - 13260172
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||||||| | ||||||||| |||||| ||| | |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg-taaaaaaaaattgtttttgttccctgtaaaattttttgtttatg |
13260087 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260088 |
aaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
13260172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 33379889 - 33380073
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
33379988 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||| |
|
|
| T |
33379989 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtagtttttggtccctgc |
33380073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 35308110 - 35307928
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaattttttgtttt |
35308011 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35308010 |
tgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
35307928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 210
Target Start/End: Original strand, 990089 - 990256
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa--tttttgtttt |
990186 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990187 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
990256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 4323827 - 4324015
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnn |
138 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||| || |||||| ||||||||||| |
|
|
| T |
4323827 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaattttttgtt |
4323926 |
T |
 |
| Q |
139 |
nnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4323927 |
tttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttatagtttttggtccctgc |
4324015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 32454293 - 32454104
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-----ttgtttttggtccctgcaaacnnnnnnnn |
137 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
32454194 |
T |
 |
| Q |
138 |
nnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32454193 |
ttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
32454104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 2733285 - 2733370
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
2733370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 21383105 - 21383288
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||| |||||| |||||||||||||||||||||| | ||||||||||||||||||| | |
|
|
| T |
21383105 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg-taaaaataaaatgtttttggtccctgcaaaattttttgtttttg |
21383203 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21383204 |
aaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc |
21383288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 21391276 - 21391192
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391276 |
gaaaatagtccctga-cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
21391192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26191360 - 26191544
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| |||||| | |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
26191459 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
26191460 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
26191544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 32626792 - 32626707
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtagtttttggtccctgc |
32626707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 18302281 - 18302197
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18302281 |
aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
18302197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 210
Target Start/End: Complemental strand, 44641431 - 44641266
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||| | |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgtaaaattttttgtttttg |
44641333 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641332 |
aaaatagtccctga-cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
44641266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29688427 - 29688246
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct---taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
29688331 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
29688330 |
aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccatttttttagtttttgttccctgc |
29688246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 45 - 226
Target Start/End: Complemental strand, 18900130 - 18899950
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaaattgtttttggtccctgcaaaattttttgttttt-aa |
18900032 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
18900031 |
aatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctg |
18899950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 10552212 - 10552127
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10552212 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttggtccctgc |
10552127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17984595 - 17984510
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984595 |
gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
17984510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 35005491 - 35005571
Alignment:
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005491 |
tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
35005571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13770490 - 13770675
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccttgcaaaattttttgttttt |
13770589 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||||| |||||||| |
|
|
| T |
13770590 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtagtttttagtccctgc |
13770675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 1159739 - 1159654
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1159739 |
gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtagtttttgatccctgc |
1159654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 34383047 - 34383132
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34383047 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttggtccctgc |
34383132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 52254184 - 52254367
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttg-taaaaaaaaattgtttttggtccctgcaaatttttttatttttt |
52254282 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| |||| | |||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
52254283 |
aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
52254367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 45 - 211
Target Start/End: Complemental strand, 15335292 - 15335124
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| | |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttttg |
15335193 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15335192 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
15335124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 50429208 - 50429024
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggttcctgcaaaattttttgttttt |
50429109 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50429108 |
gaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaaccagctttgtagtttttggtccctgc |
50429024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 4360370 - 4360451
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4360370 |
aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaattttatagtttttggtccc |
4360451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7819001 - 7818916
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| | | | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7819001 |
gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtttttggtccctgc |
7818916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 11822005 - 11822181
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| | |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
11822104 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
||| ||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
11822105 |
aaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttg |
11822181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 26442898 - 26442714
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||| | |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcacaattttttgtttt |
26442799 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442798 |
tgaaaatagtcccaca--ccacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtagtttttggtccctgc |
26442714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 46868329 - 46868413
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
46868329 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc |
46868413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 35 - 227
Target Start/End: Original strand, 3753206 - 3753397
Alignment:
| Q |
35 |
taaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnn |
134 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3753206 |
taaaataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttt |
3753303 |
T |
 |
| Q |
135 |
nnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||| |||| ||| |||| |||||||||||||||||||||||| ||| || |||||| ||| |||||||||||||||||||||| |
|
|
| T |
3753304 |
tgttttttaaaatggtccttgaccccatttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttttgtagtttttggtccctgc |
3753397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 1811170 - 1811085
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
1811170 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttggtccctgc |
1811085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 20756120 - 20756205
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||||||||| |
|
|
| T |
20756120 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc |
20756205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 166 - 227
Target Start/End: Original strand, 49226361 - 49226422
Alignment:
| Q |
166 |
tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49226361 |
tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtctctgc |
49226422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 16083154 - 16083234
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
16083154 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtcc |
16083234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29072498 - 29072684
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
29072597 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||||||||||| || |||| ||| |||||||| |||||||||||||| |
|
|
| T |
29072598 |
ttaaaatagtccctgaccccatttttgtgatgattcgcatacgtggcacaagatgactggacccattttgtaatttttggtccctgc |
29072684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 34808296 - 34808380
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
34808296 |
aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtagtttttggtccctgc |
34808380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 48609493 - 48609409
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||||||||| |
|
|
| T |
48609493 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtagtttttggtccctgc |
48609409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 990378 - 990322
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 27521575 - 27521760
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
27521575 |
aagctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggttcctgcaaaattttttgtttt |
27521674 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataac--tgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||||||||||||| || || |||||| ||||||||||||||||||||| |
|
|
| T |
27521675 |
t-aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtagtttttggtccct |
27521760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 37545850 - 37545766
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| || |||| ||||||||| ||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
37545850 |
aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtagtttttggtccctgc |
37545766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 41358370 - 41358426
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 41 - 96
Target Start/End: Original strand, 44641077 - 44641132
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641077 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1810928 - 1810982
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18302386 - 18302332
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 128
Target Start/End: Complemental strand, 19623016 - 19622931
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa |
128 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgtttttggtccctgcaaa |
19622931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 33067629 - 33067559
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
33067629 |
aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
33067559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45368491 - 45368545
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 18473594 - 18473541
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 144 - 224
Target Start/End: Complemental strand, 22953454 - 22953374
Alignment:
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
|||||||||||| || |||||||||||||||| |||||||| || ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22953454 |
aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaattttgtagtttttagtccc |
22953374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 39303874 - 39303810
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
39303874 |
ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtagtttttggtccctgc |
39303810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 45290819 - 45290763
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 35005743 - 35005692
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3753571 - 3753517
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6567495 - 6567441
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13260320 - 13260266
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21391097 - 21391151
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24507842 - 24507788
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24653803 - 24653857
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 26142521 - 26142596
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26142521 |
gaaaatagtccctgaccccacttttgtgatgatttgc--------cacattataactgaaccaattttgttgtttttggtccct |
26142596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29072861 - 29072807
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33045689 - 33045635
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35005445 - 35005499
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35307716 - 35307770
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37545629 - 37545683
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38151211 - 38151157
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38164294 - 38164240
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47819233 - 47819287
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47819595 - 47819541
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 50799131 - 50799185
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52254478 - 52254424
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 26191733 - 26191682
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 26442564 - 26442615
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 218
Target Start/End: Complemental strand, 45368847 - 45368674
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga |
143 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||||||||||||||||||| || || ||||||||||||||||| | |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaattatttttggtccctgcaaaaattttcgtttttta |
45368749 |
T |
 |
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
218 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||| |||| || ||||||| |||||||||||||| |
|
|
| T |
45368748 |
aaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtagttttt |
45368674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 98
Target Start/End: Complemental strand, 46868576 - 46868521
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3247199 - 3247253
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3247199 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3679985 - 3679931
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3679985 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 7818782 - 7818832
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7818782 |
agctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8140435 - 8140489
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8140798 - 8140744
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140798 |
gctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10631165 - 10631219
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10631527 - 10631473
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11822364 - 11822310
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12158691 - 12158745
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
12158691 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12360967 - 12360913
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12360967 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15516583 - 15516637
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15516583 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15526361 - 15526307
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16026937 - 16026883
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16026937 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16060884 - 16060830
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 17984334 - 17984384
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984334 |
gctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 17984700 - 17984650
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18079399 - 18079453
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
18079399 |
gctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19720713 - 19720767
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24507480 - 24507534
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24507480 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24977779 - 24977833
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26324586 - 26324640
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324586 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 93
Target Start/End: Complemental strand, 26324958 - 26324896
Alignment:
| Q |
31 |
tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| || ||||||||| | ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26324958 |
tatataaaataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30322930 - 30322984
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30323292 - 30323238
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30323292 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32626530 - 32626584
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33000306 - 33000360
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33000306 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33000668 - 33000614
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33234547 - 33234601
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34002939 - 34002885
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35056531 - 35056585
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35056893 - 35056839
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056893 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 38136980 - 38136926
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136980 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39747834 - 39747780
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39747834 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40718111 - 40718165
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45380273 - 45380327
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45380635 - 45380581
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380635 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45638581 - 45638635
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45638581 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 48609237 - 48609291
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 48609593 - 48609543
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 48955715 - 48955765
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 10887597 - 10887544
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887597 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 44158041 - 44157988
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44158041 |
gctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 22953555 - 22953507
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag |
91 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 32420097 - 32420153
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32420097 |
aagctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 34808200 - 34808252
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 48730509 - 48730445
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| ||||| || |||||||| ||||||||| |
|
|
| T |
48730509 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtag |
48730445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 53 - 96
Target Start/End: Original strand, 292870 - 292913
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
292870 |
ggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 18079517 - 18079572
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||| ||||||||| |
|
|
| T |
18079517 |
cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag |
18079572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 22919976 - 22919925
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
22919976 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 37624747 - 37624798
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37624747 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7819102 - 7819048
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||||||||||||||||||| ||| |
|
|
| T |
7819102 |
gctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctg |
7819048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7867130 - 7867184
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 9313004 - 9313093
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||||||| |||||||||| | ||||| | |||||| ||||| |||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9313004 |
agacgaacagagaccggtgaaacttataatacaatcaaaaggcgtcgtatataggcggaacacccgaaaataaaca-ccctaaaaacaccc |
9313093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10887234 - 10887288
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12322969 - 12322915
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 97
Target Start/End: Original strand, 17129682 - 17129744
Alignment:
| Q |
35 |
taaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||| |||||||| |||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17129682 |
taaattaaactaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24654166 - 24654112
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 648 - 777
Target Start/End: Complemental strand, 27102633 - 27102511
Alignment:
| Q |
648 |
agcaaattttattaaacaaccagaac-ctgttcaccctgttcagacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcgg |
746 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||||||||| ||| |||||| |||||||||| |||||||| || ||| |||| |||| |
|
|
| T |
27102633 |
agcaaattttattaaacaaccagatctctgttca--------agacgaacaaagactggtgaacctgagaatacaaacaaaaggtgccgtatataggcgg |
27102542 |
T |
 |
| Q |
747 |
aacacccg-aaataaacacccctaaaaacacc |
777 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |
|
|
| T |
27102541 |
aacacccgaaaataaaca-ccctaaaaacacc |
27102511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31060788 - 31060842
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 33045356 - 33045410
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33045356 |
gctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33234911 - 33234857
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33234911 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41738797 - 41738851
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
41738797 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 84
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttg |
84 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18079659 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 39025380 - 39025328
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39025380 |
gctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 21391371 - 21391319
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| ||||||||| ||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctg |
21391319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41739119 - 41739068
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41739119 |
gctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 18927890 - 18927945
Alignment:
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||||||| || ||||||||||||| |
|
|
| T |
18927890 |
ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt |
18927945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 19198836 - 19198781
Alignment:
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||| ||||| ||||| |||| |
|
|
| T |
19198836 |
ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacccattt |
19198781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 24510051 - 24510110
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
24510051 |
gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt |
24510110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33067349 - 33067400
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 45638893 - 45638846
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45638893 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4360625 - 4360571
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||| |||||||| ||||| |
|
|
| T |
4360625 |
gctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg |
4360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7867356 - 7867302
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7867356 |
gctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12360604 - 12360658
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
12360604 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 15211512 - 15211562
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15211857 - 15211803
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
15211857 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 16060597 - 16060646
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
16060597 |
gctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 16083048 - 16083098
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
16083048 |
gctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 93
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 97
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
| Q |
59 |
agtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctg |
18302108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20948756 - 20948810
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
20948756 |
gctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25658015 - 25658069
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
25658015 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||| ||||||||||||| |||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31061150 - 31061096
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31061150 |
gctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 33067732 - 33067682
Alignment:
| Q |
40 |
taagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
33067732 |
taagctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc |
34382997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40718473 - 40718419
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
40718473 |
gctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42482980 - 42483030
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 50428874 - 50428928
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||| ||||| |||||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| |||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
8364867 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac |
8364814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 10887352 - 10887401
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
10887352 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
10887401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 16026586 - 16026627
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16026586 |
ttttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16060714 - 16060763
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
16060714 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16060763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 24977898 - 24977947
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
24977898 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24977947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 37625029 - 37624976
Alignment:
| Q |
40 |
taagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
37625029 |
taagctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 49073692 - 49073745
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 19198950 - 19198894
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19198950 |
aagctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 25658282 - 25658246
Alignment:
| Q |
61 |
tccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25658282 |
tccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 33380256 - 33380204
Alignment:
| Q |
43 |
gctaaaatacggttttagtccc-tgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
33380256 |
gctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4789417 - 4789476
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
| T |
4789417 |
gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt |
4789476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 7350663 - 7350620
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctgg |
7350620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 10887306 - 10887349
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
10887349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 12322718 - 12322773
Alignment:
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||| ||||||||| |||||||||||| | ||||||||| |||| ||||||||||| |
|
|
| T |
12322718 |
ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaattt |
12322773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 12360712 - 12360771
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||| || | |||||| |||| |
|
|
| T |
12360712 |
gtccctgaccccacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt |
12360771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 17129975 - 17129916
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| || || |||||||| |||| |
|
|
| T |
17129975 |
gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt |
17129916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 46183757 - 46183800
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
46183800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 49923822 - 49923763
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||| | |||| ||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
49923822 |
actaggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1159838 - 1159784
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||| | ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
1159838 |
gctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg |
1159784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4565335 - 4565281
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||| | ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
4565335 |
gctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8364915 - 8364861
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
8364915 |
gctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 15466250 - 15466300
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
| T |
15466250 |
cccacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt |
15466300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 18928143 - 18928089
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||| ||||||||||| |
|
|
| T |
18928143 |
aagctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21383427 - 21383373
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
21383427 |
gctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg |
21383373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 22674204 - 22674254
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
22674204 |
gctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24978121 - 24978067
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
24978121 |
gctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 26142421 - 26142471
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
26142421 |
gctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtc |
26142471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 26142672 - 26142630
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttg |
84 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
26142672 |
agctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28507457 - 28507403
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
28507457 |
gctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 34002693 - 34002743
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| || ||||| ||||||| |
|
|
| T |
34002693 |
cccacttttgtgacgatttgcacacgtggcacatgatgactgagccaattt |
34002743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39747475 - 39747528
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
39747475 |
gctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 41738914 - 41738964
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
41738914 |
cccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt |
41738964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 42483213 - 42483167
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
| T |
42483213 |
cccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca |
42483167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 42483270 - 42483224
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
42483270 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 46868239 - 46868277
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
46868239 |
ttttagtccctgcaaatatgcttcattttggttttagtc |
46868277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
49073944 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacat |
49073902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 726
Target Start/End: Original strand, 7451925 - 7451962
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaa |
726 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
7451925 |
agacgaacagagaccggtgaaactgagaatacaaacaa |
7451962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 10552020 - 10551991
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10552020 |
cagggactaaaaccatattttagccaataa |
10551991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 15058765 - 15058716
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15058765 |
gctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 16026819 - 16026774
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
16026819 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
16026774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 24510307 - 24510258
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
24510307 |
gctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 24649374 - 24649345
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24649374 |
cagggactaaaaccatattttagccaataa |
24649345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg |
29579375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 188
Target Start/End: Original strand, 32420208 - 32420245
Alignment:
| Q |
151 |
ccctgaacccacttttgtgatgatttgcatacgtggca |
188 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
32420208 |
ccctgaccccacttttgtgatgatttgcacacgtggca |
32420245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 33000550 - 33000505
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
33000550 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
33000505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 33045475 - 33045524
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
33045475 |
ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
33045524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 36912854 - 36912895
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttg |
84 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
36912854 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Original strand, 37646760 - 37646797
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37646760 |
gtccctgcaaatatgcttcgttttgattttagtccctg |
37646797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 38150967 - 38151012
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
38150967 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
38151012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 765
Target Start/End: Original strand, 38544380 - 38544457
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacc |
765 |
Q |
| |
|
||||||||| ||||| |||| | |||||||| ||| ||||| ||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
38544380 |
agacgaacaaagatccgtgattcagagaatacaaactaaagacgtcgtatatatgtggaacacccgaaaataaacacc |
38544457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| |||||| ||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 39747592 - 39747641
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
| T |
39747592 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
39747641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 44157923 - 44157874
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
44157923 |
ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
44157874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
46183812 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
46183857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 99; Significance: 2e-48; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 288 - 103
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
189 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 2e-48; HSPs: 258)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 50714564 - 50714379
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
50714465 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50714464 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
50714379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 6827873 - 6827687
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
6827774 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6827773 |
tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
6827687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 38054549 - 38054731
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
38054648 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38054649 |
aatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtagtttttggtccctgc |
38054731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51709026 - 51708841
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
51708927 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51708926 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
51708841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32208543 - 32208727
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||| | |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaattgtttttggtccctacaaaattttttgtttttg |
32208642 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32208643 |
aaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
32208727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 35415300 - 35415486
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35415300 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
35415399 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35415400 |
tgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
35415486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13479273 - 13479456
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| | |||||||||||||||| ||| | |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactcccta-taaaaaaaaattgtttttggtccctgtaaaattttttgtttttg |
13479371 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479372 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
13479456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41620255 - 41620069
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41620255 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
41620156 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
41620155 |
tgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttggagtttttgatccctgc |
41620069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 43 - 225
Target Start/End: Complemental strand, 16712690 - 16712509
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||| | |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggtctctgcaaaattttttgtttttg |
16712592 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16712591 |
taaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttggtccct |
16712509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 43 - 225
Target Start/End: Complemental strand, 55482467 - 55482286
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||| |||| ||| | |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg-taaaaaaaaattgtttttggttcctgtaaaattttttgtttttg |
55482369 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55482368 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttggtccct |
55482286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 4279233 - 4279148
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4279233 |
gaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
4279148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 34355065 - 34355150
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34355065 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
34355150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 36702001 - 36702185
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| || |||||| ||||||||||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgtttttgtttttagtccctgcaaaattttttgttttt |
36702100 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36702101 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtagtttttggtccctg |
36702185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 52017869 - 52017687
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaattttttgtttt |
52017770 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52017769 |
tgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
52017687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 47 - 225
Target Start/End: Complemental strand, 27008401 - 27008223
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaa |
146 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttgaaaa |
27008302 |
T |
 |
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27008301 |
tagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct |
27008223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 45 - 223
Target Start/End: Complemental strand, 51545966 - 51545788
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttcgtttttaaa |
51545867 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
51545866 |
aatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtcc |
51545788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29463912 - 29463727
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
29463813 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
29463812 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagttttttgtccctgc |
29463727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 142 - 224
Target Start/End: Complemental strand, 34362044 - 34361962
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362044 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
34361962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 41346217 - 41346036
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttg-tttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| ||||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaatcatttttggtccctgcaaaattttttgttttt |
41346118 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346117 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
41346036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 41921083 - 41920898
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
41921083 |
gctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt |
41920984 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41920983 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
41920898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 18205157 - 18205341
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
18205256 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
18205257 |
aaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaactaattttgtagtttttggtccctgc |
18205341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 27427944 - 27428029
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtagtttttggtccctgc |
27428029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9446322 - 9446138
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | |||||||||||| ||||||| |||||||||||||| ||||||| |||||||||||||||||||| | |
|
|
| T |
9446322 |
gctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
9446223 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9446222 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataacaaaaccaattttgtagtttttggtccctgc |
9446138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 13064160 - 13064335
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||| ||||| | |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg-taaaaaaaaattgtttttggtccccgcaaaattttttgtttttg |
13064258 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
13064259 |
taaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgtaatttttg |
13064335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 24474861 - 24474776
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24474861 |
gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtagttttgggtccctgc |
24474776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35763954 - 35763768
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35763954 |
gctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgtttt |
35763855 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
35763854 |
tgaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaattttctagtttttgatccctgc |
35763768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 9289267 - 9289449
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
9289366 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9289367 |
tgaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaattttctagtttttggtccctgc |
9289449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 18136014 - 18135931
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct |
18135931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 49123222 - 49123139
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccct |
49123139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 22584606 - 22584424
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
22584606 |
gctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
22584509 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22584508 |
aaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaattttgtagtttttgatccctgc |
22584424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 32365095 - 32365280
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
32365194 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
32365195 |
taaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtagtttttggtccctgc |
32365280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 46087860 - 46087943
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46087860 |
gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaattttgtagtttttggtccctgc |
46087943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 123793 - 123708
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
123793 |
gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtagttttcggtccctgc |
123708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 55072492 - 55072572
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55072492 |
aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttatagtttttggtcc |
55072572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 5063105 - 5063188
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5063105 |
gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtagtttttggtccct |
5063188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45505893 - 45505706
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaattttttttttttgtttttggtccctgcaaatttttttgttt |
45505794 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||| |||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||||||| |
|
|
| T |
45505793 |
tttaaattagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttggtccctgc |
45505706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 161 - 227
Target Start/End: Complemental strand, 50822178 - 50822112
Alignment:
| Q |
161 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50822178 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
50822112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45593229 - 45593411
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||||||||||| | | |||||||||||||||||| |
|
|
| T |
45593229 |
gctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg-taaaaaaaaatagtttttggtccctgcaaaaatttttgtttttt |
45593327 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45593328 |
aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
45593411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 210
Target Start/End: Complemental strand, 53717173 - 53717004
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaattttttgtttt |
53717074 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
210 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53717073 |
ttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
53717004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 142 - 224
Target Start/End: Original strand, 3178784 - 3178866
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||||||| || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3178784 |
gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaattttgtagtttttgatccc |
3178866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 18830946 - 18831031
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18830946 |
gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtagtttttgatccctgc |
18831031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 2180471 - 2180387
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| |||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
2180471 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtagtttttggtccctgc |
2180387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 143 - 222
Target Start/End: Complemental strand, 22099809 - 22099730
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
222 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
22099809 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtc |
22099730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 35415632 - 35415576
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 35763648 - 35763704
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 41345854 - 41345910
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13064464 - 13064410
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 52017506 - 52017560
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 52441764 - 52441942
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
52441861 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||| ||| | || |||||||| ||||||||||||||||||| |
|
|
| T |
52441862 |
aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtagtttttggtcc |
52441942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 52429829 - 52429898
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
52429829 |
cccatttttgtgatgatttgcatacgtggcacattataacttaataaattttgtagtttttggttcctgc |
52429898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 123535 - 123591
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 50714241 - 50714297
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 13479615 - 13479556
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13479615 |
actaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 22099544 - 22099595
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 33 - 96
Target Start/End: Complemental strand, 29420546 - 29420483
Alignment:
| Q |
33 |
tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29420546 |
tataaactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 98
Target Start/End: Complemental strand, 46088059 - 46088004
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2034854 - 2034800
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2180221 - 2180275
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13530712 - 13530658
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23245232 - 23245286
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24774046 - 24774100
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27008085 - 27008139
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29499183 - 29499237
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30046791 - 30046737
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30061132 - 30061078
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32365482 - 32365428
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35464381 - 35464327
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 36054149 - 36054095
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36054149 |
gctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 42848390 - 42848336
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43231388 - 43231334
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45505601 - 45505655
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46115415 - 46115469
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46128549 - 46128603
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 55072390 - 55072444
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 23778965 - 23779014
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 24474962 - 24474909
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 28809179 - 28809126
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 43368467 - 43368651
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttta |
43368566 |
T |
 |
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||| ||| |||| |||| |||||||||||||||||||||||| || | |||| ||| ||||||||||||||||| |||| |
|
|
| T |
43368567 |
aaatagtcgttgaccccatttttatgatgatttgcatacgtggcacataatgaatgaacccatttttgtagtttttggtctctgc |
43368651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 6827547 - 6827603
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggt |
6827603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 9289634 - 9289582
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 51708694 - 51708750
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggt |
51708750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 4211562 - 4211617
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4211562 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 5052583 - 5052532
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 6353638 - 6353583
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6353638 |
agctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29380909 - 29380858
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 34361804 - 34361855
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 36702363 - 36702308
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
36702363 |
agctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5827972 - 5827918
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5882553 - 5882606
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8191390 - 8191336
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8760780 - 8760726
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12791973 - 12791919
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12791973 |
gctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13073760 - 13073814
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13631229 - 13631283
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13631598 - 13631544
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13631598 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14487803 - 14487857
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14791805 - 14791751
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22099911 - 22099857
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
22099857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25423925 - 25423979
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25424311 - 25424257
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26412583 - 26412529
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35464019 - 35464073
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43231089 - 43231143
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46115778 - 46115724
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46128912 - 46128858
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46292393 - 46292447
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46292393 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 46292650 - 46292600
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 51545630 - 51545680
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52430099 - 52430045
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 52442091 - 52442037
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 53915684 - 53915738
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53915684 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 53916058 - 53915992
Alignment:
| Q |
31 |
tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| || ||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
53916058 |
tatataaaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 54903474 - 54903420
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54903474 |
gctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 23245601 - 23245540
Alignment:
| Q |
36 |
aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23245601 |
aaactaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 93
Target Start/End: Original strand, 28448828 - 28448885
Alignment:
| Q |
36 |
aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
28448828 |
aaactaggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 32208900 - 32208847
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32208900 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 11285605 - 11285689
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||| | || |||| | | ||||||||||||||||||||||| |
|
|
| T |
11285605 |
aaaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtagtttttggtccctgc |
11285689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 15555639 - 15555587
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15555639 |
aagctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 97
Target Start/End: Original strand, 2322093 - 2322148
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2322093 |
agctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 4279334 - 4279283
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279334 |
gctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 11692870 - 11692929
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
11692870 |
gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacccattt |
11692929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 12152497 - 12152438
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
12152497 |
actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13074124 - 13074073
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
13074124 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 29380669 - 29380724
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 29420436 - 29420365
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||| || | ||||||||||||||||| |||||||||||||||| || | |||||| ||||||||| |
|
|
| T |
29420436 |
gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag |
29420365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 53716922 - 53716973
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
53716922 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 2034552 - 2034594
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034552 |
ttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4279023 - 4279077
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4279023 |
gctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5827656 - 5827710
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8760605 - 8760659
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11693120 - 11693066
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13764614 - 13764668
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14488186 - 14488132
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19321858 - 19321804
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20291987 - 20292037
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20291987 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 22584288 - 22584338
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23779224 - 23779170
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26412191 - 26412245
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412191 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27427873 - 27427926
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27427873 |
gctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28809012 - 28809066
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31560332 - 31560386
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31560332 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31560694 - 31560640
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31812212 - 31812158
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34355282 - 34355228
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34355282 |
gctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35119293 - 35119347
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35119293 |
gctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41324889 - 41324835
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
41324889 |
gctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42848028 - 42848082
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 45474595 - 45474545
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45474595 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45593585 - 45593531
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 689 - 766
Target Start/End: Complemental strand, 48098723 - 48098645
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacaccc |
766 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||||||||| | || |||| |||||||||||| |||||||||||| |
|
|
| T |
48098723 |
agacgaacggagatcggtgaaactgaaaatacaaacaaaagacgcagtatataggcggaacacccgaaaataaacaccc |
48098645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 53308067 - 53308013
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 123893 - 123840
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagt-ccctggt |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggt |
123840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
7642544 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
7642491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcg-ttttggttttagtccct |
96 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 25358460 - 25358396
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||| | ||||||||||| || ||||||| ||||||||| |
|
|
| T |
25358460 |
gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag |
25358396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 2180571 - 2180520
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2180571 |
gctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 5797711 - 5797652
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
5797711 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5797652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 8904887 - 8904934
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8904887 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 13530488 - 13530547
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
13530488 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
13530547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 24474601 - 24474651
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24474601 |
gctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 25424203 - 25424144
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
25424203 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
25424144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 29463611 - 29463658
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29463611 |
gctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
36050402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 37556837 - 37556896
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||| |||||||| || ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
37556837 |
actaggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| |||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 58 - 97
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
| Q |
58 |
tagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctg |
54208516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2322431 - 2322377
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2322431 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
5827764 |
gtccctgaccccacttttgtgatgatttgcatatgtggcacat |
5827806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12152155 - 12152209
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12152155 |
gctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13530380 - 13530434
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13530380 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18136112 - 18136058
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18136112 |
gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19321571 - 19321625
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19321571 |
gctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25358539 - 25358485
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26314331 - 26314277
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26314331 |
gctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31182503 - 31182449
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
31182503 |
gctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31811926 - 31811980
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31811926 |
gctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 766
Target Start/End: Complemental strand, 42719573 - 42719495
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacaccc |
766 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||| | ||| |||| |||||| ||| | |||||||||||| |
|
|
| T |
42719573 |
agacgaatagagaccggtgaaactgagaatacaaacaaaagacgccgtatataagcggaaaacctgaaaataaacaccc |
42719495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42823777 - 42823831
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 44925486 - 44925536
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
44925486 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47023104 - 47023050
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47023104 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 49123320 - 49123266
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49123320 |
gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51738138 - 51738192
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg |
51738192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51738410 - 51738356
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
51738410 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 11692763 - 11692816
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
11692763 |
gctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 24774308 - 24774259
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
24774308 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24774259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 31370805 - 31370854
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31370805 |
gctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 47135897 - 47135942
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
47135897 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacca |
47135942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 47274229 - 47274180
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
47274229 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
51738362 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
51738309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg |
51830944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 54208706 - 54208657
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
54208706 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
54208657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 25358498 - 25358454
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
25358498 |
ggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4211610 - 4211669
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
4211610 |
gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
4211669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Original strand, 5063021 - 5063064
Alignment:
| Q |
54 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
5063021 |
gttttagtccctgcaaatataccttgttttggtttaagtccctg |
5063064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 327
Target Start/End: Original strand, 5063309 - 5063340
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaac |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5063309 |
cagggactaaaaccatattttagccaataaac |
5063340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13764806 - 13764755
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
13764806 |
gctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14594207 - 14594258
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14594207 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 20144730 - 20144683
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| || | |||||||||||||||||||||||||| |
|
|
| T |
20144730 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 24774354 - 24774311
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
24774311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 31811996 - 31812039
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
31812039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 35119610 - 35119559
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
35119610 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 36050395 - 36050454
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| || || |||||||| |||| |
|
|
| T |
36050395 |
gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt |
36050454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42824090 - 42824039
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || |||||| ||||||||| |
|
|
| T |
42824090 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 47135851 - 47135894
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
47135894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 51763129 - 51763086
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
51763086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 2034735 - 2034693
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaa |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
2034735 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
2034693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctg |
11692876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 203
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacc |
203 |
Q |
| |
|
|||||||| | |||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
12791865 |
gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
12791811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26313989 - 26314043
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
26313989 |
gctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 35119381 - 35119431
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| || |||||||| |||| |
|
|
| T |
35119381 |
cccacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt |
35119431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 41439909 - 41439951
Alignment:
| Q |
161 |
acttttgtgatgatttgcatacgtggcacattataactgaacc |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
41439909 |
acttttgtgatgatttgcacacgtggcacatgatgactgaacc |
41439951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 47023027 - 47022989
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
47023027 |
gtccctgcaaatatgcctcattttggttttggtccctgg |
47022989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51762871 - 51762925
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||| || ||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
51762871 |
gctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg |
51762925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 54208747 - 54208709
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
54208747 |
gtccctgcaaatatgcctcattttggttttggtccctgg |
54208709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 7639895 - 7639944
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||||| |||||| |||||| |||||||| || |||||||||||| |
|
|
| T |
7639895 |
aagctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 8191288 - 8191216
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||||||| |||| | ||||||| ||||||||| |
|
|
| T |
8191288 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag |
8191216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 8905233 - 8905180
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||| ||||| ||||| ||||| |
|
|
| T |
8905233 |
gctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
14488078 |
gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac |
14488025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| ||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 227
Target Start/End: Original strand, 41316068 - 41316097
Alignment:
| Q |
198 |
tgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41316068 |
tgaaccaattttgtagtttttggtccctgc |
41316097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46115660 - 46115611
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
| T |
46115660 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46115611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46128794 - 46128745
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
| T |
46128794 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46128745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 47022986 - 47022937
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
47022986 |
ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
47022937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| ||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 99; Significance: 2e-48; HSPs: 281)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 37506868 - 37507053
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaattttttttgttttt |
37506967 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37506968 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
37507053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39288897 - 39288713
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| | |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgattttggtccctgcaaaattttttgtttttg |
39288798 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288797 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
39288713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39437108 - 39436922
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
39437009 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39437008 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc |
39436922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 10976979 - 10977164
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccctgcaaaattttttgttttt |
10977078 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977079 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtagtttttggtccctgc |
10977164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 28427607 - 28427422
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
28427508 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28427507 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttggtccctgc |
28427422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 22155930 - 22156116
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
22156029 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156030 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
22156116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3152110 - 3151925
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt |
3152011 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3152010 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttttttccctgc |
3151925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 225
Target Start/End: Original strand, 8510215 - 8510399
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
8510314 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8510315 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
8510399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 45 - 227
Target Start/End: Original strand, 20757403 - 20757585
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
20757502 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20757503 |
aatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
20757585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51834941 - 51834756
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaactttttgttttt |
51834842 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51834841 |
gaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaattttgtagtttttggtccctgc |
51834756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 275445 - 275628
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||| | |
|
|
| T |
275445 |
gctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgc-aaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
275543 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275544 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
275628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45320978 - 45320794
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| | |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttgatccctgcaaaattttttgtttttg |
45320879 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45320878 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtccctgc |
45320794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 13584105 - 13584190
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
13584190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 45 - 227
Target Start/End: Complemental strand, 20907454 - 20907271
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnnga |
143 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |||||||||||||| ||| | |||||||||||||||||||| || |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga |
20907355 |
T |
 |
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20907354 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
20907271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 21159816 - 21159634
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt |
21159717 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21159716 |
tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
21159634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 26799889 - 26800075
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
26799988 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
26799989 |
tgaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttttagtttttgttccctgc |
26800075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 40169653 - 40169467
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| || ||||||||||||| |||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaattttttgtttt |
40169554 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40169553 |
tgaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc |
40169467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 29955300 - 29955485
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt |
29955399 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtagtttttggtccctgc |
29955485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 44 - 227
Target Start/End: Original strand, 30004454 - 30004639
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt |
30004553 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtagtttttggtccctgc |
30004639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 14633888 - 14633701
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
|||||| || |||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14633888 |
gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
14633789 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14633788 |
ttgaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
14633701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 216
Target Start/End: Complemental strand, 20612897 - 20612724
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| | |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccttgcaaatttttttgtttttg |
20612798 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
216 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
20612797 |
gaaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtagttt |
20612724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 34238599 - 34238784
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
34238698 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34238699 |
gaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtagttttttatccctgc |
34238784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 39072212 - 39072027
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn- |
141 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
39072212 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaaaaaaaaaattgtttttggtccctgcaaattttttttgttttt |
39072113 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072112 |
gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
39072027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 4950266 - 4950181
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4950266 |
gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
4950181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 67 - 227
Target Start/End: Complemental strand, 10778706 - 10778546
Alignment:
| Q |
67 |
caaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtccctgaacccactttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||| || |||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccctggtaaaaaaaaattgttattggtccctgcaaaattttttgtttttgaaaatagtccctgaccctactttt |
10778607 |
T |
 |
| Q |
167 |
gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10778606 |
gtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc |
10778546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 223
Target Start/End: Complemental strand, 19656802 - 19656721
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
19656721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 30130159 - 30130343
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||| | |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
30130258 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30130259 |
aaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtagtttttggtccctgc |
30130343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 45161116 - 45161294
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||| ||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
45161215 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45161216 |
aatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtcc |
45161294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 31869955 - 31869771
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||| | |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaactttttgtttttg |
31869856 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31869855 |
aaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttatagtttttggtccctgc |
31869771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 224
Target Start/End: Complemental strand, 4513619 - 4513438
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattgtttttggtccctgcaaaattttttgtttttt |
4513520 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccc |
224 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
4513519 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccc |
4513438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 18175889 - 18175973
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18175889 |
aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
18175973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 25710869 - 25710686
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtc--tgcaaaattttttattttt |
25710772 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25710771 |
gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
25710686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 3830135 - 3830317
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||| | |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg--taaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
3830232 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
3830233 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtagttttttgtccctgc |
3830317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 7518346 - 7518261
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7518346 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtagtttttggtccctgc |
7518261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 12673904 - 12673819
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagttttttgtccctgc |
12673819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 16123242 - 16123327
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16123242 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttgatccctgc |
16123327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 49670721 - 49670652
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49670721 |
cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
49670652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 51500684 - 51500500
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
51500585 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||| ||| ||||||||| ||||||||||||| |
|
|
| T |
51500584 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtaggttttggtccctgc |
51500500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 43 - 208
Target Start/End: Complemental strand, 5345688 - 5345522
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaatttgtttttgatccctgcaaaattttttattttt |
5345589 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345588 |
taaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
5345522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 46186669 - 46186584
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||||||||| |
|
|
| T |
46186669 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc |
46186584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 50261839 - 50261755
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50261839 |
gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaattttgtagtttttggtccctgc |
50261755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 15016645 - 15016561
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||||||||| |
|
|
| T |
15016645 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttggtccctgc |
15016561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 9863403 - 9863221
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatagtttttggtccttgcaaaattttttgttttt |
9863304 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccactttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9863303 |
gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc |
9863221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 43 - 210
Target Start/End: Original strand, 29445955 - 29446124
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
29446054 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
210 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29446055 |
ttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
29446124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 45521650 - 45521735
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45521650 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttggtccctgc |
45521735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 53701476 - 53701545
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
53701476 |
cccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttggtccctgc |
53701545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 15286402 - 15286318
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||||||||| |
|
|
| T |
15286402 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc |
15286318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 22156304 - 22156236
Alignment:
| Q |
31 |
tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156304 |
tataaaaattaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 51759922 - 51760006
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||| ||| ||||||||| ||||||||||||| |
|
|
| T |
51759922 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtaggttttggtccctgc |
51760006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 142 - 204
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47901901 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca |
47901963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 4814897 - 4814719
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcccta-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
4814800 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||||||||||||| || |||| ||| ||||||||||||||||||| |
|
|
| T |
4814799 |
aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtagtttttggtcc |
4814719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 151 - 227
Target Start/End: Complemental strand, 30426175 - 30426099
Alignment:
| Q |
151 |
ccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30426175 |
ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtagtttttgatccctgc |
30426099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 30552246 - 30552330
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| || | |||| |||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
30552246 |
aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
30552330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 51834609 - 51834665
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 50196401 - 50196484
Alignment:
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| || | ||||||||||||||||||||||||||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
50196401 |
aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtagtttttggtccctgc |
50196484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4513264 - 4513318
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4950038 - 4950092
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37507221 - 37507167
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 689 - 778
Target Start/End: Original strand, 50518753 - 50518842
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| |||||| |||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
50518753 |
agacgaacagagactggtgaaactgagaatacaaacaaaaggtgtcgtatataggcggaacacccgaaaataaaca-ccctaaaaacaccc |
50518842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 3151751 - 3151804
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 13584366 - 13584310
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 28942904 - 28942848
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 39436719 - 39436775
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 43440614 - 43440678
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
43440614 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtctctgc |
43440678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3830515 - 3830464
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 14633547 - 14633602
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggt |
14633602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 160 - 219
Target Start/End: Original strand, 40979479 - 40979538
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
40979479 |
cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgtaatttttg |
40979538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 51550070 - 51550137
Alignment:
| Q |
30 |
ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||| || ||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550070 |
ttataaaaagtaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 41 - 99
Target Start/End: Complemental strand, 3361819 - 3361761
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3361819 |
aagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
3361761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15016389 - 15016443
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16123140 - 16123194
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22008527 - 22008581
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 22008889 - 22008835
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22016045 - 22016099
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25615976 - 25616030
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28552382 - 28552328
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30268506 - 30268560
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31480137 - 31480191
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 49323783 - 49323837
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 53701662 - 53701608
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 54608519 - 54608573
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 9262154 - 9262102
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 10977340 - 10977284
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| || |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977340 |
gctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 11463231 - 11463287
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11463231 |
aagctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 20611021 - 20611077
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggt |
20611077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 28427246 - 28427302
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 143 - 219
Target Start/End: Original strand, 30268585 - 30268661
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||| ||||| || |||||||| ||||| ||||||||| |
|
|
| T |
30268585 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttatagtttttg |
30268661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 39288574 - 39288630
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt |
39288630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 40370588 - 40370536
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 689 - 775
Target Start/End: Complemental strand, 4171161 - 4171075
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaaca |
775 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||| ||||| |||| |||||||||| | ||||||||| ||||||||||| |
|
|
| T |
4171161 |
agacgaacagagaccggtgaaactgagaatacaaacaaaaggcgtcgtatataggcggaacacctgaaaataaaca-ccctaaaaaca |
4171075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 7957118 - 7957059
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
7957118 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
7957059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46751272 - 46751323
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 474045 - 474099
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
474045 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1721451 - 1721397
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1721451 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4034718 - 4034772
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9261790 - 9261844
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9261790 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12673645 - 12673699
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 12740908 - 12740962
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12741270 - 12741216
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12741270 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15979339 - 15979393
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15979339 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19844580 - 19844526
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26089731 - 26089785
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26089731 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26090077 - 26090023
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28552022 - 28552076
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28552022 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 29955661 - 29955611
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 30004816 - 30004766
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30106219 - 30106165
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30106219 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 31480499 - 31480445
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| || ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480499 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32119583 - 32119529
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32119583 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 43441602 - 43441548
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441602 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44802283 - 44802337
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45002022 - 45002076
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45002384 - 45002330
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45002384 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46186770 - 46186716
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctg |
46186716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47336229 - 47336283
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336229 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47336580 - 47336526
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47336580 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48924239 - 48924185
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48924239 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 50196656 - 50196602
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 51550445 - 51550391
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 54608862 - 54608808
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54608862 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 9603630 - 9603683
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603630 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 25610131 - 25610078
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25610131 |
aagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 190
Target Start/End: Original strand, 28942526 - 28942674
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
28942526 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccctgcaaaattttatgttttt |
28942625 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcaca |
190 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28942626 |
taaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca |
28942674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 49670802 - 49670745
Alignment:
| Q |
43 |
gctaaaatacggttttagtccc-tgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49670802 |
gctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 51760118 - 51760069
Alignment:
| Q |
42 |
agctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag |
91 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51760118 |
agctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 14772212 - 14772264
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772212 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 34238914 - 34238858
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
34238914 |
gctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt |
34238858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 40169345 - 40169401
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40169345 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3387603 - 3387552
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3387603 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 7518091 - 7518142
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7518091 |
gctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
48 |
aatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 19656542 - 19656593
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21159454 - 21159505
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
21159454 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29446205 - 29446154
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
29446205 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 93
Target Start/End: Complemental strand, 29490747 - 29490692
Alignment:
| Q |
38 |
actaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29490747 |
actaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29525106 - 29525157
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 40277931 - 40277990
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
40277931 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40277990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 43440774 - 43440735
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43440774 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 47005518 - 47005467
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
47005518 |
gctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 52342582 - 52342531
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52342582 |
gctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
474407 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4035052 - 4034998
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
4035052 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7957225 - 7957171
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7957225 |
gctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9597094 - 9597040
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9597094 |
gctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 15286157 - 15286207
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
15286157 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15979700 - 15979646
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21553890 - 21553944
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
21553890 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg |
21553944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 25710515 - 25710565
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28452375 - 28452321
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30552477 - 30552423
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35565509 - 35565563
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35565509 |
gctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40545565 - 40545619
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40545565 |
gctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40979709 - 40979655
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
40979709 |
gctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45313862 - 45313808
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
45313862 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47005155 - 47005209
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
47005155 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 51759820 - 51759874
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||| |||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
51759820 |
gctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 681 - 776
Target Start/End: Complemental strand, 25648109 - 25648013
Alignment:
| Q |
681 |
ccctgttca-gacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacac |
776 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |||||||| | || |||| ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25648109 |
ccctgttcaagacgaacagagatcggtgaaactaagaatacaaacaaaaggcgcagtatatagacggaacacccgaaaataaaca-ccctaaaaacac |
25648013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 30034353 - 30034304
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
30034353 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
30034304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 43440496 - 43440549
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 144 - 213
Target Start/End: Complemental strand, 45313759 - 45313690
Alignment:
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||| || |||||||| ||||||||| |
|
|
| T |
45313759 |
aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag |
45313690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 30426225 - 30426174
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
30426225 |
gctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 4034826 - 4034885
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
4034826 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4034885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 9262045 - 9261986
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
9262045 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9261986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 9603918 - 9603871
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
9603918 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 30130499 - 30130452
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30130499 |
aaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 52342196 - 52342243
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
52342196 |
gctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 2486784 - 2486734
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
2486784 |
cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2486734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7588319 - 7588369
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
7588319 |
gctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19844266 - 19844320
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
19844266 |
gctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 27681681 - 27681627
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||| | ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27681681 |
gctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29678025 - 29678079
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29678025 |
gctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 30034471 - 30034417
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30128285 - 30128339
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 30424629 - 30424679
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || ||||| ||||||||| |
|
|
| T |
30424629 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32119221 - 32119275
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32119221 |
gctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 692 - 766
Target Start/End: Original strand, 33143619 - 33143693
Alignment:
| Q |
692 |
cgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaataaacaccc |
766 |
Q |
| |
|
|||||| | |||||||||||||||||||| | |||||| ||| | |||| ||||||||||||||| |||||||| |
|
|
| T |
33143619 |
cgaacataaatcggtgaaactgagaatacaaccaaaaggcgtcatatataggcggaacacccgaaaaaaacaccc |
33143693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
36673072 |
gtccctgaccccacttttgtgatgatttacatacgtggcacat |
36673114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40277823 - 40277877
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40277823 |
gctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46622128 - 46622074
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 46901222 - 46901276
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
217 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
46901222 |
ttttttgatgatttgcatacgtgacacatgataactgaactcattttgtagtttt |
46901276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 47114488 - 47114538
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
47114488 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 95
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||| |||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 47902144 - 47902090
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
47902144 |
gctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg |
47902090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 51500399 - 51500449
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
51500399 |
gctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 275832 - 275783
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| | |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
275832 |
gctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| |||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9596976 - 9596927
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
9596976 |
ccacttttgagatgatttgcatacgtggcacatgatgactgaacccattt |
9596927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||| | ||||||||| |||| |||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg |
14772470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| ||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 20405104 - 20405055
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || |||||||| |||| |
|
|
| T |
20405104 |
ccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
20405055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 25353200 - 25353241
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttg |
84 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25353200 |
gctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 35177256 - 35177305
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35177256 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35177374 - 35177423
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
35177374 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35177423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 35565627 - 35565676
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
35565627 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35565676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 46901105 - 46901154
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
46901105 |
gctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 732 - 784
Target Start/End: Original strand, 1652583 - 1652635
Alignment:
| Q |
732 |
gtcgtttatatgcggaacacccgaaataaacacccctaaaaacacccttgcga |
784 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
1652583 |
gtcgtatataggcggaacacccgaaataaacacccacaaagacacccttgcga |
1652635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 92
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 25610060 - 25610016
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25610060 |
ggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 97
Target Start/End: Complemental strand, 28418901 - 28418845
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
28418901 |
aagctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 35533395 - 35533439
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
35533395 |
cccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
35533439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| ||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 128
Target Start/End: Original strand, 49670477 - 49670560
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaa |
128 |
Q |
| |
|
||||||| | ||||||||| |||||||||| || |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggtaaaaaaaaattgtttttggtccctgcaaa |
49670560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaa |
201 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
52342473 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
52342421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 94
Target Start/End: Original strand, 590197 - 590228
Alignment:
| Q |
63 |
cctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
590197 |
cctgcaaatatgcctcgttttggttttagtcc |
590228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 3387338 - 3387381
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
3387381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 8555199 - 8555140
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |||| | ||||||||||||| |
|
|
| T |
8555199 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacacgacgactgaaccaattt |
8555140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 92
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||| | ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13514576 - 13514525
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
13514576 |
gctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 92
Target Start/End: Complemental strand, 16123490 - 16123452
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16123490 |
ggttttagtcc-tgcaaatatgcctcgttttggttttagt |
16123452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 18175792 - 18175844
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
18175792 |
gctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctg |
18175844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 28418659 - 28418702
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaa |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
28418659 |
cccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
28418702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28452148 - 28452199
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||| |||||||||| || |||||||||||||||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 35565581 - 35565624
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtctctgg |
35565624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 203
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
| Q |
152 |
cctgaacccacttttgtgatgatttgcatacgtggcacattataactgaacc |
203 |
Q |
| |
|
||||| |||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
36732750 |
cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc |
36732801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 38232242 - 38232293
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
38232242 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 39132834 - 39132791
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgg |
39132791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 45005959 - 45006002
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
45006002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 52956627 - 52956584
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
52956584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 53113496 - 53113551
Alignment:
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||| |||||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
| T |
53113496 |
ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacctattt |
53113551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Complemental strand, 15016412 - 15016382
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15016412 |
cagggactaaaaccatattttagccaataaa |
15016382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20405222 - 20405168
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| | | ||||| ||||||||||||| |
|
|
| T |
20405222 |
gctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20644506 - 20644560
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
20644506 |
gctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20644875 - 20644821
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||| || ||||||| |||||||||||| |
|
|
| T |
20644875 |
gctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 20757774 - 20757724
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | ||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
20757774 |
gctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc |
20757724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25609768 - 25609822
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
25609768 |
gctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg |
25609822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29686545 - 29686599
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||| |||||| |||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||| |||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35407789 - 35407735
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
35407789 |
gctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35498417 - 35498471
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| || |||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
35498417 |
gctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40370286 - 40370340
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
40370286 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
50009029 |
gtccatgaccccacttttgtgatgatttgcacacgtggcacat |
50009071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 50009283 - 50009229
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| || |||||| |||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
50009283 |
gctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg |
50009229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 50261935 - 50261885
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
50261935 |
gctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 53113444 - 53113490
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttt |
89 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
53113444 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 53701362 - 53701416
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||| |||| ||||||||||||| |
|
|
| T |
53701362 |
gctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctg |
53701416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 8940406 - 8940361
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
8940406 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
8940361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
9603738 |
gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac |
9603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 11463362 - 11463313
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
11463362 |
ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
11463313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 12741026 - 12741071
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
12741026 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
12741071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 14772330 - 14772383
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
211 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| || | |||||| ||||||| |
|
|
| T |
14772330 |
cccacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt |
14772383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 16679857 - 16679796
Alignment:
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||| | || ||||||||||||||||| |||||||||| || |||||||| |||| |
|
|
| T |
16679857 |
tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt |
16679796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 98
Target Start/End: Original strand, 20644584 - 20644621
Alignment:
| Q |
61 |
tccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
20644584 |
tccctgcaaatatgtctcgttttggttttggtccctgg |
20644621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||| | || ||||| ||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 22008771 - 22008726
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
22008771 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
22008726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 22016289 - 22016244
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
22016289 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
22016244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 80
Target Start/End: Complemental strand, 26273823 - 26273786
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgt |
80 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
26273823 |
gctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 29678386 - 29678333
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
29678386 |
gctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Complemental strand, 33794788 - 33794751
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33794788 |
gtccctgcaaatatgcctcgttttaattttagtccctg |
33794751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
40370465 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40370420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 97
Target Start/End: Original strand, 40560492 - 40560529
Alignment:
| Q |
60 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40560492 |
gtccctgcaaatatgcctcgttttaattttagtccctg |
40560529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 45002140 - 45002185
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
45002140 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
45002185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 45006005 - 45006054
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
45006005 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
45006054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 98; Significance: 7e-48; HSPs: 232)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 44508721 - 44508905
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccctgcaaaaatttttgtttttg |
44508820 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44508821 |
aaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtagtttttggtccctgc |
44508905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 45073640 - 45073456
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg |
45073541 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073540 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
45073456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 7431952 - 7432138
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
7432051 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432052 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
7432138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 35015219 - 35015033
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgtttt |
35015120 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35015119 |
tgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
35015033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 17999720 - 17999538
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
17999623 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17999622 |
aaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
17999538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 37372903 - 37372719
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| | |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
37372804 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37372803 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtagtttttggtccctgc |
37372719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1007228 - 1007043
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1007228 |
gctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
1007129 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1007128 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
1007043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 44344788 - 44344605
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| | |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg |
44344690 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44344689 |
aaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaattttatagtttttggtccctgc |
44344605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 45021495 - 45021682
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttgg-ttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| |||||||||| |
|
|
| T |
45021495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccctgcaaaattttttgttt |
45021594 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45021595 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
45021682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 6108596 - 6108511
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
6108511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 39719455 - 39719540
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719455 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
39719540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 28911578 - 28911764
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
28911677 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28911678 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtagtttttggtccctgc |
28911764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19783816 - 19784001
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtccctgcaaatttttttgttttt |
19783915 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19783916 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggttcctgc |
19784001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 45 - 223
Target Start/End: Original strand, 30352563 - 30352743
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||| || |||||| ||||||||||| | |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaattttttgtttttg |
30352662 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30352663 |
aaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
30352743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1559704 - 1559520
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| | |
|
|
| T |
1559704 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
1559605 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1559604 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttataatttttggtccctgc |
1559520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 12894301 - 12894216
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894301 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
12894216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 31732350 - 31732265
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31732350 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
31732265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 48359074 - 48358891
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttg-taaaaaaaaattgtttttgatccctgcaaaattttttgtttttt |
48358976 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48358975 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
48358891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 18022357 - 18022552
Alignment:
| Q |
32 |
atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn |
131 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||| ||||||||| ||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
18022357 |
atataatcaaagctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcctataaaaaaaaaattgtttttggtccctgcaaaatt |
18022456 |
T |
 |
| Q |
132 |
nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18022457 |
ttttattttttaaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
18022552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 19561155 - 19561333
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| | |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc-----aaaaaaattttgtttttggtccctgcaaaattttttgtttttg |
19561249 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561250 |
aaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctg |
19561333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 21223508 - 21223592
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
21223592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 54 - 227
Target Start/End: Complemental strand, 5308675 - 5308501
Alignment:
| Q |
54 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnngaaaatagtcc |
152 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
5308675 |
gttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttttgaaaatagtct |
5308576 |
T |
 |
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308575 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
5308501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 21554752 - 21554567
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn-ttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
21554752 |
gctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
21554653 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21554652 |
gaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtagtttttgatccctgc |
21554567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 39832907 - 39833090
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |||| | |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-taaaaaaaaattgtttttggtccctacaaatttttttgtttttg |
39833005 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
39833006 |
aaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttngtagtttttagtccctgc |
39833090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 488814 - 488899
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488814 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
488899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 18311682 - 18311766
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18311682 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttggtccctgc |
18311766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 44403248 - 44403067
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||| ||||||| | |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctataaaaaaaaaattgtttttggtcactgcaaa--aaattgttttag |
44403151 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44403150 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtagtttttggtccctg |
44403067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 142 - 222
Target Start/End: Complemental strand, 46304281 - 46304201
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304281 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
46304201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19757749 - 19757936
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttgttttgtttttggtccttgcaaattcttttgttt |
19757848 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19757849 |
ttgaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
19757936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 45 - 211
Target Start/End: Original strand, 30709328 - 30709494
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnngaa |
144 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||| ||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
30709427 |
T |
 |
| Q |
145 |
aatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30709428 |
aatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
30709494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 35210411 - 35210326
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| | | ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35210411 |
gaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtagtttttggtccctgc |
35210326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 10358105 - 10358189
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
10358105 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttgatccctgc |
10358189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 31310577 - 31310493
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
31310577 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtagtttttggtccctgc |
31310493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 219
Target Start/End: Original strand, 14738700 - 14738777
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14738700 |
gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtaatttttg |
14738777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 20388275 - 20388456
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnt-tgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaaatctgtttttggtccctgcaaaattttttgtcttt |
20388374 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||||||||| || || |||||||| ||||||||||||||||||| |
|
|
| T |
20388375 |
taaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtagtttttggtcc |
20388456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 13769775 - 13769957
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| || | ||||||||||||| |||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg-taaaaaaaaattgtttttggtccttgcaaaattttttgtttttt |
13769873 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| || | ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13769874 |
aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc |
13769957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 207
Target Start/End: Complemental strand, 25547489 - 25547325
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||| |||||| | |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
25547390 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaatt |
207 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25547389 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaatt |
25547325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 19465735 - 19465804
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19465735 |
cccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
19465804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 1006836 - 1006892
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 6108335 - 6108391
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 23816933 - 23816849
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||| ||||||||||||| || ||| |||| ||||||||||||||||||||||| |
|
|
| T |
23816933 |
aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc |
23816849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 44509053 - 44508997
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 1974207 - 1974140
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1974207 |
cactattgtgatgatttgcatacgtgacaaattataactgaaccaattttttagtttttggtccctgc |
1974140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 205
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
205 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22871162 |
gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
22871225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12894401 - 12894347
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28911905 - 28911851
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 41 - 97
Target Start/End: Original strand, 6079808 - 6079864
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6079808 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 46648516 - 46648599
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||| |||||||||||| || |||||||| |||||||||||||| |||||||| |
|
|
| T |
46648516 |
aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtagtttttagtccctgc |
46648599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 1614903 - 1614849
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3975550 - 3975604
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6509209 - 6509263
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 6509469 - 6509415
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8144657 - 8144603
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8555798 - 8555744
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9659688 - 9659634
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10358367 - 10358313
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 16853588 - 16853534
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17999466 - 17999520
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19561449 - 19561395
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 23399613 - 23399667
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23676451 - 23676397
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25988748 - 25988694
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 26878070 - 26878016
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 29198661 - 29198607
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35210514 - 35210460
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39833235 - 39833181
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 45228917 - 45228863
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48192487 - 48192433
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 21223747 - 21223694
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 14739003 - 14738947
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 30352903 - 30352847
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30352903 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
30352847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 43300730 - 43300794
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||| || |||||||| ||| ||||||||||||||||||| |
|
|
| T |
43300730 |
ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtagtttttggtccctgc |
43300794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3975837 - 3975786
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18022703 - 18022652
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1614560 - 1614614
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1614560 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1974010 - 1974064
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5233809 - 5233863
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5233809 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5354769 - 5354823
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8144296 - 8144350
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10358002 - 10358056
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358002 |
gctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg |
10358056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13770080 - 13770026
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23399975 - 23399921
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23399975 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 23816671 - 23816721
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25092161 - 25092215
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25092547 - 25092493
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25092547 |
gctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25988386 - 25988440
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27037594 - 27037648
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27037594 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27458400 - 27458454
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27458400 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 31732102 - 31732156
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 35104290 - 35104240
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35665878 - 35665932
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35838336 - 35838282
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39719641 - 39719587
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 41054235 - 41054181
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44402961 - 44403015
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45073315 - 45073369
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 32189278 - 32189209
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| || | |||||| ||||||||||||||||||||||| |
|
|
| T |
32189278 |
cccatttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtagtttttggtccctgc |
32189209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 45021855 - 45021806
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 1271588 - 1271544
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1271588 |
ggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 689 - 753
Target Start/End: Original strand, 6726083 - 6726147
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacaccc |
753 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| | | ||| |||| ||||||||||| |
|
|
| T |
6726083 |
agacgaacagagatcggtgaaactgagaatacaaacaaaaaacgccgtatataggcggaacaccc |
6726147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 41365094 - 41365031
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||||||||| |||||||| || |||||||| ||||||||| ||||||||||||| |
|
|
| T |
41365094 |
ttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtag-ttttggtccctgc |
41365031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 45671314 - 45671394
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||| ||||||| | || ||||||||||||||||||||||| ||||| || ||||||| |||||||||||||| |||| |
|
|
| T |
45671314 |
aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtagttttttgtcc |
45671394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 6589022 - 6589073
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6589022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21554394 - 21554445
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 30223794 - 30223743
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
30223794 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 35837925 - 35837976
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35837925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46304087 - 46304138
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46304087 |
gctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 46648714 - 46648667
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 46759659 - 46759710
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 48852445 - 48852496
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
48852445 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1559344 - 1559398
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
1559344 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2945844 - 2945790
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2945844 |
gctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 5234203 - 5234149
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 5308324 - 5308378
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11767274 - 11767220
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 12932782 - 12932728
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12932782 |
gctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16940763 - 16940817
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||| |||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16940763 |
gctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 21223406 - 21223456
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21223406 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28262714 - 28262768
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
28262714 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 29198304 - 29198358
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29198304 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30223462 - 30223516
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 30709643 - 30709593
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 39438742 - 39438792
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 39439028 - 39438974
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 39719354 - 39719404
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39719354 |
gctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41053843 - 41053897
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41053843 |
gctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 44568327 - 44568381
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568327 |
gctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44568689 - 44568635
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46304383 - 46304329
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46759941 - 46759887
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 46828945 - 46828999
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
46828945 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||| |||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 18311579 - 18311628
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18311579 |
aagctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310678 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
35665984 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac |
35666037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 5355106 - 5355066
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5355106 |
ggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
| Q |
57 |
ttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctg |
12894096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 97
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
| Q |
57 |
ttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctg |
19758004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 31732450 - 31732402
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag |
91 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
31732450 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 689 - 768
Target Start/End: Complemental strand, 8745546 - 8745467
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccgaaataaacacccct |
768 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||| ||| | ||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
8745546 |
agacgaacagagactggtgaaactgaaaatagaaacaagagacgccgtatataggcggaacacccgaaaaaaacacccct |
8745467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 9659464 - 9659523
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
9659464 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9659523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 14543711 - 14543762
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 14738613 - 14738652
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14738613 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 32189077 - 32189124
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32189077 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| |||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 489071 - 489017
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
489071 |
gctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 7432249 - 7432195
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggt |
7432195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9659356 - 9659410
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
9659356 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 19465979 - 19465926
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
19465979 |
gctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg |
19465926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20388674 - 20388620
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
20388674 |
gctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 24954049 - 24953979
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
||||||||| ||| | ||||||| |||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
24954049 |
aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag |
24953979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 26877679 - 26877733
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
26877679 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31310366 - 31310416
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31310366 |
gctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 727
Target Start/End: Complemental strand, 33719382 - 33719344
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaa |
727 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33719382 |
agacgaacagagatcggtgaaactgagaatacaaacaaa |
33719344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 35104091 - 35104133
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35104091 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35470279 - 35470225
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35470279 |
gctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 39520399 - 39520453
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 41364885 - 41364939
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| || || |||||||| |||||||||||||||||||||| |
|
|
| T |
41364885 |
gctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg |
41364939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44958505 - 44958451
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44958505 |
gctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 45228616 - 45228670
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| | ||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
45228616 |
gctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 46829311 - 46829257
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
46829311 |
gctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 5354999 - 5354950
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
5354999 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5354950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 6892266 - 6892205
Alignment:
| Q |
36 |
aaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||| ||| || ||||||| ||||||||||| |
|
|
| T |
6892266 |
aaactaggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 11767036 - 11767085
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
11767036 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
11767085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 24717531 - 24717478
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24717531 |
gctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 94
Target Start/End: Original strand, 24953831 - 24953872
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
24953831 |
ggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 30223580 - 30223629
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
30223580 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
30223629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 35104125 - 35104186
Alignment:
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
| T |
35104125 |
tagtccctgactccacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt |
35104186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 38186642 - 38186589
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| || |||||||| ||||||||| |
|
|
| T |
38186642 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag |
38186589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 39520517 - 39520566
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
39520517 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
39520566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 689 - 781
Target Start/End: Original strand, 42532923 - 42533015
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacc-cgaaataaacacccctaaaaacacccttg |
781 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| | |||||| | ||| |||| |||||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
42532923 |
agacgaacagagaccggtggaactgagaatacaaccaaaaggcgccgtatataggcggaacacctggaaataaaca-ccctaaaaactcccttg |
42533015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg |
43058805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Complemental strand, 37952950 - 37952902
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
37952950 |
aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacat |
37952902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 96
Target Start/End: Complemental strand, 45671558 - 45671494
Alignment:
| Q |
32 |
atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||| || | ||||||| |||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
45671558 |
atataaaataggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 6911246 - 6911199
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
6911246 |
gctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
46 |
aaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 16940881 - 16940924
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
16940881 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
16940924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 27458472 - 27458515
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
27458515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 34878124 - 34878077
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34878124 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
| Q |
161 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
35470159 |
acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35470112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 35470207 - 35470164
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctgg |
35470164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 35838033 - 35838092
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||| ||| |||| |
|
|
| T |
35838033 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactggacccattt |
35838092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 41054103 - 41054060
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
41054060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 46759864 - 46759805
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
46759864 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
46759805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacat |
191 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
2945736 |
gtccctggccccacttttgtgatgatttgcacacgtggcacat |
2945694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3807865 - 3807919
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3807865 |
gctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 326
Target Start/End: Complemental strand, 7431975 - 7431945
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7431975 |
cagggactaaaaccatattttagccaataaa |
7431945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 186
Target Start/End: Complemental strand, 17854356 - 17854314
Alignment:
| Q |
144 |
aaatagtccctgaacccacttttgtgatgatttgcatacgtgg |
186 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
17854356 |
aaatagtccctgactccatttttgtgatgatttgcatacgtgg |
17854314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 18927090 - 18927040
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
18927090 |
gctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22539931 - 22539985
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
22539931 |
gctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 23817033 - 23816979
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||| ||||||||||| ||||| |||| |
|
|
| T |
23817033 |
gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 97
Target Start/End: Complemental strand, 27458698 - 27458664
Alignment:
| Q |
63 |
cctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctg |
27458664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28528906 - 28528960
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
28528906 |
gctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35210183 - 35210237
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
35210183 |
gctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 35469881 - 35469931
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35469881 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 38186747 - 38186709
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
38186747 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 38486673 - 38486631
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
38486673 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaac |
38486631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 38486789 - 38486739
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||| |||||||||||||||| |
|
|
| T |
38486789 |
gctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 44841473 - 44841523
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
| T |
44841473 |
cccacttttgtgatgatttggacacgtggcacatgatgactgaacccattt |
44841523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 48854069 - 48854015
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48854069 |
gctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 3975730 - 3975677
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||||||||||| || ||||||| |
|
|
| T |
3975730 |
gtccctgactccacttttgtaatgatttgcacacgtggcacatgatgactgaac |
3975677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 6589080 - 6589129
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
6589080 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
6589129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 18926889 - 18926942
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||| | | |||||||| ||||||||||||| |||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg |
18926942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 27458518 - 27458567
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
27458518 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
27458567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 296 - 325
Target Start/End: Complemental strand, 31732125 - 31732096
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31732125 |
cagggactaaaaccatattttagccaataa |
31732096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 34877885 - 34877942
Alignment:
| Q |
152 |
cctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
209 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| ||||||| || | |||||| ||||| |
|
|
| T |
34877885 |
cctgaccccacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt |
34877942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 41054057 - 41054008
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
41054057 |
ccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
41054008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 45228707 - 45228752
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
45228707 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
45228752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 97; Significance: 3e-47; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8548 - 8734
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
8647 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8648 |
tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
8734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 91; Significance: 1e-43; HSPs: 214)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 6146950 - 6146762
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnn |
138 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6146950 |
aagctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaatttttttgtt |
6146851 |
T |
 |
| Q |
139 |
nnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6146850 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
6146762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 1525797 - 1525996
Alignment:
| Q |
30 |
ttatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaa |
127 |
Q |
| |
|
||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
1525797 |
ttatataaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaa |
1525896 |
T |
 |
| Q |
128 |
acnnnnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1525897 |
aattttttgtttttgaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtagtttttggtccctgc |
1525996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 218
Target Start/End: Original strand, 4375693 - 4375867
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||| | |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg-taaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
4375791 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4375792 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
4375867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 33636323 - 33636509
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaattttttgtttt |
33636422 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33636423 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtagtttttggtccctgc |
33636509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 19494120 - 19494305
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggtttt |
19494219 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
19494220 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttctagtccctgc |
19494305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 38930303 - 38930488
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt-gtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgttttt |
38930402 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38930403 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcgctgc |
38930488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 41 - 223
Target Start/End: Original strand, 4016904 - 4017085
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||| |
|
|
| T |
4016904 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaaaaaaaaat-gtttttggtccctgcaaaattttttgtttt |
4017002 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4017003 |
ttaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
4017085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 16644043 - 16643858
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaattttttgtttt |
16643944 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16643943 |
tgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttggtccctg |
16643858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 16789368 - 16789187
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtcccagcaaa---attttgttttg |
16789272 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16789271 |
aatatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttggtccctgc |
16789187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 41 - 227
Target Start/End: Original strand, 6146515 - 6146701
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6146515 |
aagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
6146614 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
6146615 |
tgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattaggttgtttttggtccctgc |
6146701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 28399034 - 28398853
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
28399034 |
gctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg---taaaaaaattgtttttggtccctgcaaaattttttgtttttg |
28398938 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398937 |
aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
28398853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 24187570 - 24187753
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| | |||||||||| || |||||| | |
|
|
| T |
24187570 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg-taaaaaaaaattgtttttggcccgtgcaaatttttttgtttttg |
24187668 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187669 |
aaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtagtttttggtccctgc |
24187753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 24955009 - 24954825
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||| || || |||||||||| |||||| | |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaaaaaaaattatttttggtccttgcaaaaaaatttgtttttg |
24954910 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24954909 |
aaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataacaaaaccaattttgtagtttttggtccctgc |
24954825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 8094480 - 8094666
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8094480 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaattttttgtttt |
8094579 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8094580 |
tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
8094666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 25131112 - 25131294
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||| | |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaatattgattttggtccctgcaaa-tttttttgttttg |
25131210 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25131211 |
aaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctg |
25131294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 1162910 - 1163098
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtgtt |
1163009 |
T |
 |
| Q |
141 |
n--gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163010 |
tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
1163098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 1408352 - 1408172
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||| | |
|
|
| T |
1408352 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttatttttg |
1408253 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
1408252 |
aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaattttatagtttttggtcc |
1408172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 14495299 - 14495214
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtagtttttggtccctgc |
14495214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 21509796 - 21509881
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtagtttttgatccctgc |
21509881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 22917826 - 22917741
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttggtccctgc |
22917741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 21125919 - 21125835
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125919 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttggtccctgc |
21125835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 10776498 - 10776313
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaattttttgtttt |
10776399 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10776398 |
tgaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtagtttttggtccctg |
10776313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 27341590 - 27341404
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgt--ttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttgtttt |
27341491 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||| | || ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27341490 |
tgaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
27341404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 22650568 - 22650651
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
22650568 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtagtttttggtccct |
22650651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 7272522 - 7272607
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7272522 |
gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtagtttttggtccctgc |
7272607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 14488717 - 14488901
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |||||| | |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaaaaaaaaatttgtttttggtccttgcaaatttttttgtttttg |
14488816 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
14488817 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
14488901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 29488109 - 29487925
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttt |
29488010 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||| ||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
29488009 |
aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtagtttttggtccctgc |
29487925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 32040272 - 32040187
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
32040272 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtagtttttgatccctgc |
32040187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 143 - 227
Target Start/End: Original strand, 15719758 - 15719842
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
15719758 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc |
15719842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 43 - 205
Target Start/End: Original strand, 40492961 - 40493117
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||||||||||||||| || ||||||||||||||||| | |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg------taattttttttttggtccctgcaaaattttttgtttttg |
40493054 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40493055 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
40493117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 43 - 222
Target Start/End: Original strand, 40066498 - 40066675
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||| |||| | ||||||||||||| |||||| | |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg-taaaaaaaaattgtttttggtcc-tgcaaaattttttgtttttg |
40066595 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtc |
222 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
40066596 |
aaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttataatttttggtc |
40066675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 14238752 - 14238932
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtcc-tgcaaaattatttgttttt |
14238850 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||||| |
|
|
| T |
14238851 |
taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtagtttttggtcc |
14238932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 18549305 - 18549390
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||||||||| |
|
|
| T |
18549305 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtagtttttggtccctgc |
18549390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 30337023 - 30337108
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| | || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
30337023 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtagtttttggtccctgc |
30337108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 10755429 - 10755345
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
10755429 |
aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttggtccctgc |
10755345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 19963099 - 19963179
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||| |
|
|
| T |
19963099 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtagtttttggtcc |
19963179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 29158355 - 29158541
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaattttttgtttt |
29158454 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| || | |||||||||||||| |||| ||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158455 |
tgaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaattttgtagtttttggtccctgc |
29158541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 32418577 - 32418493
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||||||||| |
|
|
| T |
32418577 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttggtccctgc |
32418493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 33526155 - 33526235
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||| |
|
|
| T |
33526155 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttggtcc |
33526235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 43727328 - 43727244
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
43727328 |
aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
43727244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 45 - 200
Target Start/End: Original strand, 1685117 - 1685274
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt--nnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||| | |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtcactgcaaaattttttgcttttg |
1685216 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactga |
200 |
Q |
| |
|
||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685217 |
aaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga |
1685274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 31 - 227
Target Start/End: Complemental strand, 7578539 - 7578345
Alignment:
| Q |
31 |
tatataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacn |
130 |
Q |
| |
|
||||||| |||||||||||||||||||| | |||||||||||| ||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7578539 |
tatataatttaagctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcct--gtaaaaaaaaattgtttttggtccctgcaaaat |
7578442 |
T |
 |
| Q |
131 |
nnnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| ||| || | ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
7578441 |
tttttgttttttaaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtccctgc |
7578345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19494412 - 19494356
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 22917565 - 22917621
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 35143854 - 35143664
Alignment:
| Q |
32 |
atataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnn |
131 |
Q |
| |
|
||||||| || ||||||||| ||||||| ||| || |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35143854 |
atataaaataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctgaaaaaaaaaaattgtttttggtccctgcaaaatt |
35143755 |
T |
 |
| Q |
132 |
nnnnnnnnnngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||| ||||||||| ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
35143754 |
ttttattttttaaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaaccgattttatagtttttggtcc |
35143664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 223
Target Start/End: Complemental strand, 40844434 - 40844354
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || | ||| || ||||||||||||||||||| |
|
|
| T |
40844434 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtagtttttggtcc |
40844354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 143 - 223
Target Start/End: Complemental strand, 43477411 - 43477331
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||| | ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
43477411 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtagtttttggtcc |
43477331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14239079 - 14239025
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 43477164 - 43477218
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1526171 - 1526115
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 16643662 - 16643718
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 32418319 - 32418370
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 2728596 - 2728542
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4017299 - 4017245
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4710219 - 4710165
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7272750 - 7272696
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7326420 - 7326366
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 11019856 - 11019802
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11976374 - 11976428
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 14495070 - 14495124
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 28346395 - 28346449
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28346757 - 28346703
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 32726270 - 32726216
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 33526411 - 33526357
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 34963301 - 34963355
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35097691 - 35097637
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 37536087 - 37536141
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 40066819 - 40066765
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 40844157 - 40844211
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 25131446 - 25131393
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 8094840 - 8094788
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 38930663 - 38930607
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 1778565 - 1778619
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 3511907 - 3511961
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3511907 |
gctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3512265 - 3512211
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4474043 - 4473989
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474043 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4621353 - 4621299
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7186003 - 7185949
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7272421 - 7272471
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7326087 - 7326141
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7326087 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 7420231 - 7420285
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 7420589 - 7420535
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7420589 |
gctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 8298588 - 8298642
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 8298974 - 8298920
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8298974 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 9496722 - 9496668
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9496722 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10337120 - 10337174
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10337448 - 10337394
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10337448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10540781 - 10540727
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10540781 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 10872916 - 10872970
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10872916 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10873279 - 10873225
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10873279 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 11019521 - 11019575
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11019521 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 14489072 - 14489018
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 219
Target Start/End: Original strand, 14496817 - 14496991
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||| |||||| | |
|
|
| T |
14496817 |
gctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct--ataaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
14496914 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
219 |
Q |
| |
|
||||| |||||||| | || ||||||||||||||||||| ||||||||| || |||||||| |||||||| |||||| |
|
|
| T |
14496915 |
aaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttg |
14496991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16789076 - 16789130
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 18549202 - 18549252
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20277693 - 20277747
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20277693 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 20984147 - 20984201
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21064320 - 21064374
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21064320 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 21125720 - 21125774
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 22650465 - 22650519
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24187896 - 24187842
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24187896 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32725908 - 32725962
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 34963663 - 34963609
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35097329 - 35097383
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35345616 - 35345562
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 35346630 - 35346684
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35346997 - 35346943
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 37536418 - 37536364
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37536418 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 42133153 - 42133099
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 5357424 - 5357477
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5357424 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 10755527 - 10755474
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
10755527 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| ||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 28323850 - 28323903
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28323850 |
gctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 97
Target Start/End: Original strand, 9496336 - 9496396
Alignment:
| Q |
37 |
aactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9496336 |
aactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 15719657 - 15719709
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccc |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| | |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 20278056 - 20278005
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20278056 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 21064683 - 21064632
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21064683 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 28497363 - 28497422
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
28497363 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
28497422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33526053 - 33526104
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526053 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 35115590 - 35115531
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| || |||||||| |||| |
|
|
| T |
35115590 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
35115531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2728233 - 2728287
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 4473705 - 4473759
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 6469281 - 6469335
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| || ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6469281 |
gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| || ||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 17073808 - 17073862
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17574462 - 17574408
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 20984509 - 20984455
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25600231 - 25600285
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35115638 - 35115584
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
35115638 |
gctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42132865 - 42132919
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 10540450 - 10540503
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10540450 |
gctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 13232561 - 13232512
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
13232561 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 27117975 - 27117922
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
27117975 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 1163273 - 1163217
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
1163273 |
gctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggt |
1163217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtt |
87 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40493156 |
gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
7420346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 8298696 - 8298755
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
8298696 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
8298755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
13232314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
20277808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
21064435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 28497256 - 28497307
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
28497256 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 29158668 - 29158617
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29158668 |
gctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 92
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctgg |
42430004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42430119 - 42430068
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 227
Target Start/End: Original strand, 1686477 - 1686511
Alignment:
| Q |
193 |
ataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1686477 |
ataactgaaccaattttgtagtttttggtccctgc |
1686511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 3680800 - 3680746
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3680800 |
gctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4376009 - 4375960
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376009 |
gctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||||| | |||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 9175013 - 9175067
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 13154887 - 13154941
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13154887 |
gctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 13155250 - 13155196
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13155250 |
gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 19962996 - 19963050
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||| ||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
19962996 |
gctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 21126020 - 21125966
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
21126020 |
gctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 24815067 - 24815013
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| | ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24815067 |
gctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 25600596 - 25600542
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
25600596 |
gctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 25702513 - 25702567
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
25702513 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 27117754 - 27117808
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
27117754 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 28324180 - 28324126
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
28324180 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 29992295 - 29992245
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29992295 |
aaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 32040076 - 32040130
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | | |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32040076 |
gctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 7326205 - 7326254
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
7326205 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7326254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 7420349 - 7420398
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
7420349 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7420398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg |
13779204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
20277801 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
20277854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
21064428 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
21064481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 36044793 - 36044744
Alignment:
| Q |
41 |
aagctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||||| |||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
36044793 |
aagctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||| ||||||| |||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 1408006 - 1408054
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttag |
91 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
| Q |
54 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctg |
1778874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 2811559 - 2811610
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || ||| |||| ||||| |
|
|
| T |
2811559 |
cccacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt |
2811610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 4473777 - 4473820
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
4473777 |
ttttagtccctgcaaatatgccttattttggttttggtccctgg |
4473820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 6469557 - 6469498
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| |||||||||||||| |||| | |||||||||||||| |||||||| |||| |
|
|
| T |
6469557 |
gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacccattt |
6469498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 10540522 - 10540565
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
98 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
10540565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 96
Target Start/End: Original strand, 14847844 - 14847879
Alignment:
| Q |
61 |
tccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14847844 |
tccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
| Q |
147 |
tagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | ||| ||||| || ||||||| |
|
|
| T |
23939654 |
tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac |
23939709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 28258240 - 28258189
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
28258240 |
gctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 78
Target Start/End: Original strand, 28398757 - 28398792
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctc |
78 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28398757 |
gctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29487751 - 29487802
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29487751 |
gctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 29992192 - 29992133
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||| ||||| || |||||||| |||| |
|
|
| T |
29992192 |
gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
29992133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 42430011 - 42429952
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||| |||| ||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
42430011 |
gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
42429952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 44997932 - 44997979
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
44997932 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 1778683 - 1778725
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaa |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
1778683 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
1778725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 9175254 - 9175204
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
| T |
9175254 |
cccacttttgtgatgatttgcacacatggcacatgatgactgaacccattt |
9175204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 10873158 - 10873112
Alignment:
| Q |
163 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
10873158 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccatttt |
10873112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| || ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 15931151 - 15931101
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
15931151 |
cccacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt |
15931101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 26530673 - 26530723
Alignment:
| Q |
47 |
aaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||| |||| |
|
|
| T |
26530673 |
aaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 42429759 - 42429812
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
42429759 |
gctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 44998146 - 44998104
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaa |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
44998146 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
44998104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 4473823 - 4473872
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
| T |
4473823 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
4473872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 11976617 - 11976572
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
204 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
11976617 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
11976572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 13232317 - 13232366
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
13232317 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
13232366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 23939548 - 23939597
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
23939548 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 85; Significance: 4e-40; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 1643 - 1457
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn--ttgtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1643 |
gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
1544 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttggtccctgc |
1457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 1312 - 1368
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 85; Significance: 4e-40; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 12183 - 12369
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttt |
12282 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12283 |
tgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
12369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 12535 - 12484
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 83; Significance: 7e-39; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 5707 - 5520
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnn---ttgtttttggtccctgcaaacnnnnnnnnnn |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
5608 |
T |
 |
| Q |
140 |
nngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5607 |
ttgaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
5520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 5400 - 5456
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
5400 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
5456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 79; Significance: 2e-36; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 14698 - 14878
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnn |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||| ||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgtttt-ggtccctgtaaaattttttgttttt |
14796 |
T |
 |
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14797 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
14878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 15011 - 14957
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 78; Significance: 6e-36; HSPs: 3)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 4311 - 4127
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaatttgtttttcgtccctgcaaaattttttgttttta |
4212 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211 |
aaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
4127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 4020 - 4064
Alignment:
| Q |
53 |
ggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4020 |
ggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 296 - 327
Target Start/End: Original strand, 4288 - 4319
Alignment:
| Q |
296 |
cagggactaaaaccatattttagccaataaac |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4288 |
cagggactaaaaccatattttagccaataaac |
4319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 78; Significance: 6e-36; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3290 - 3106
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| |||||||| | |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtacctgcaaaattttttgtttttg |
3191 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3190 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtagtttttggtccctgc |
3106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 77; Significance: 3e-35; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 9027 - 8842
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaattttttgtttt |
8928 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8927 |
tgaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgatccctgc |
8842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
44 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 74; Significance: 2e-33; HSPs: 2)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 17942 - 17857
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17942 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtagtttttggtccctgc |
17857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 18042 - 17988
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 71; Significance: 1e-31; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 366272 - 366090
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
366175 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
366174 |
aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtagtttttggtccctgc |
366090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 365980 - 366034
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 70; Significance: 4e-31; HSPs: 3)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 10257 - 10338
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtcc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10257 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttggtcc |
10338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10169 - 10220
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 10514 - 10460
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
10514 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 213
Target Start/End: Original strand, 5210 - 5382
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||| |||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgtttt |
5309 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5310 |
tgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 43 - 213
Target Start/End: Original strand, 5230 - 5402
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnntt--gtttttggtccctgcaaacnnnnnnnnnnn |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||| |||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgtttt |
5329 |
T |
 |
| Q |
141 |
ngaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5330 |
tgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 67; Significance: 2e-29; HSPs: 2)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 35170 - 35087
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35170 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt--tagtttttggtccctgc |
35087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 34932 - 34988
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 62; Significance: 2e-26; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 43 - 227
Target Start/End: Original strand, 2779 - 2962
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttc |
2877 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||| |||||||||||| || |||| ||| | ||||||||||||||||||||| |
|
|
| T |
2878 |
aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtagtttttggtccctgc |
2962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 58; Significance: 5e-24; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 3917 - 3734
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnnttgtttttggtccctgcaaacnnnnnnnnnnnng |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg-taacttttttttgtttttggtccttgcaaaattttttgtttttt |
3819 |
T |
 |
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
|||||||||||||| | || |||||| |||||||||||||||||||||| || ||| ||| ||||||||||||||||||||||| |
|
|
| T |
3818 |
aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtagtttttggtccctgc |
3734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3533 - 3584
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 58; Significance: 5e-24; HSPs: 3)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 8432 - 8517
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctgc |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
8432 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttggtccctgc |
8517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8331 - 8382
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 8641 - 8590
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 56; Significance: 9e-23; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 94160 - 94243
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccctg |
226 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||| |
|
|
| T |
94160 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttggtacctg |
94243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 94058 - 94112
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
90 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 24558 - 24475
Alignment:
| Q |
142 |
gaaaatagtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttggtccct |
225 |
Q |
| |
|
|||||||||| |||| || || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
24558 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttttgtccct |
24475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 24373 - 24427
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 47; Significance: 2e-17; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 54816 - 54870
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 47; Significance: 2e-17; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 82705 - 82651
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 82342 - 82396
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 82460 - 82509
Alignment:
| Q |
159 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||| ||||||||| |
|
|
| T |
82460 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt |
82509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 75763 - 75709
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 75360 - 75414
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 45; Significance: 3e-16; HSPs: 6)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 4042 - 4098
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
4098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 99
Target Start/End: Original strand, 19224 - 19280
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
19280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 4287 - 4231
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
4231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 19469 - 19413
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
99 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
19413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #5
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 4128 - 4175
Alignment:
| Q |
151 |
ccctgaacccacttttgtgatgatttgcatacgtggcacattataact |
198 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4128 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
4175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #6
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 19310 - 19357
Alignment:
| Q |
151 |
ccctgaacccacttttgtgatgatttgcatacgtggcacattataact |
198 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19310 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
19357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 12526 - 12577
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 27363 - 27309
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 17965 - 17911
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 17863 - 17791
Alignment:
| Q |
143 |
aaaatagtccctgaacccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
213 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||||||| |||| | ||||||| ||||||||| |
|
|
| T |
17863 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag |
17791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 47926 - 47980
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
45 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 223171 - 223120
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
223171 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 148281 - 148227
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 148007 - 148050
Alignment:
| Q |
160 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
148007 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
148050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 2659 - 2606
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2659 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 2413 - 2463
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
2413 |
cccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4078 - 4028
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
4078 |
gctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 97
Target Start/End: Original strand, 3743 - 3807
Alignment:
| Q |
33 |
tataaactaagctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
|||||| || ||||||||| |||||| |||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
3743 |
tataaaataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 36; Significance: 0.00000000007; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 22054 - 22003
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
94 |
Q |
| |
|
||||||||| |||||| |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
22054 |
gctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 21808 - 21858
Alignment:
| Q |
158 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | || | ||||||||||| |
|
|
| T |
21808 |
cccacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt |
21858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
55 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 16725 - 16779
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| | |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16725 |
gctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 16832 - 16891
Alignment:
| Q |
149 |
gtccctgaacccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
16832 |
gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
16891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 689 - 778
Target Start/End: Complemental strand, 37124 - 37034
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacccctaaaaacaccc |
778 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| ||||||||| | || |||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
37124 |
agacgaacagagaccggtgaaactgataatacaaacaaaagacgctgtatataggcggaacatccgaaaataaacaccataaaaaacaccc |
37034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 3454 - 3405
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
92 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3454 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 34; Significance: 0.000000001; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 2502 - 2555
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2502 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 2882 - 2829
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct |
96 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2882 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 2615 - 2664
Alignment:
| Q |
153 |
ctgaacccacttttgtgatgatttgcatacgtggcacattataactgaac |
202 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||||||| || ||||||| |
|
|
| T |
2615 |
ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac |
2664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 35083 - 35029
Alignment:
| Q |
43 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
97 |
Q |
| |
|
||||||||| |||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
35083 |
gctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1613 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold1613
Description:
Target: scaffold1613; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 689 - 765
Target Start/End: Original strand, 659 - 736
Alignment:
| Q |
689 |
agacgaacagagatcggtgaaactgagaatactaacaaaagatgtcgtttatatgcggaacacccg-aaataaacacc |
765 |
Q |
| |
|
||||||||| ||||| |||| | |||||||| ||| ||||| ||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
659 |
agacgaacaaagatccgtgattcagagaatacaaactaaagacgtcgtatatatgtggaacacccgaaaataaacacc |
736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University