View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4842_low_1 (Length: 772)
Name: NF4842_low_1
Description: NF4842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4842_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 637 - 753
Target Start/End: Complemental strand, 47841157 - 47841041
Alignment:
| Q |
637 |
acctgtgctgcattgttcttaaatacaggaagaaatcgttgcctacaatattgattaaatagaacggtaccgatcaacaatggaattgtaaatccagctg |
736 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47841157 |
acctgtgctgcattgttcttaaatacaggaagaaatcgttgcctacaatattgattaaatagaacggtaccgatcaacaatggaattgtaaatccagctg |
47841058 |
T |
|
| Q |
737 |
caactgttgatcgtttt |
753 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47841057 |
caactgttgatcgtttt |
47841041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University