View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4842_low_11 (Length: 215)
Name: NF4842_low_11
Description: NF4842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4842_low_11 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 105 - 215
Target Start/End: Original strand, 3105922 - 3106030
Alignment:
| Q |
105 |
aatatggaccgacgtcggatgaaagaccgttcacgctttgatgacccatattcacaaagcagcggcacttagagattaacaacctccatcttccaattag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3105922 |
aatatggaccgacgtcggatgaaagaccgttca-gctttgatgacc-atattctcaaagcagcggcacttagagattaacaacctccatcttccaattag |
3106019 |
T |
 |
| Q |
205 |
tgagatgacaa |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
3106020 |
tgagatgacaa |
3106030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 3105314 - 3105384
Alignment:
| Q |
1 |
tcaccaactaataacattcttttgaatactacttcatgtagctatttacatatataatttacatcaaatca |
71 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3105314 |
tcaccaactaataacatttttttgaatactacttcatgtagctattgacatatataatttacatcaaatca |
3105384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University