View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4843-Insertion-11 (Length: 212)
Name: NF4843-Insertion-11
Description: NF4843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4843-Insertion-11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 7046973 - 7047177
Alignment:
| Q |
8 |
attccgacgccaaatccttccaacaaccttcccatatagagaaaagaagaatcctgaaagatgcaaatattgttatgttattaattgaagtaacactaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7046973 |
attccgacgccaaatccttccaacaaccttcccatatagagaaaagaagaatcctgaaagatgcaaatattgttatgttattaattgaagtaacactaat |
7047072 |
T |
|
| Q |
108 |
agtcgttttatcaccgtagggatttgaactcggtcccttgaggctataaggtcaaacacttaccattgagttgacatctctgtgtacaaatgcaaaacat |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7047073 |
agtcgttttatcaccatagggatttgaactcggtcccttgaggttataaggtcaaacacttactactgagttgacatctccgtgtacaaatgcaaaacat |
7047172 |
T |
|
| Q |
208 |
gttat |
212 |
Q |
| |
|
||||| |
|
|
| T |
7047173 |
gttat |
7047177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 41337709 - 41337654
Alignment:
| Q |
127 |
ggatttgaactcggtcccttgaggctataaggtcaaacacttaccattgagttgaca |
183 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||||||||| ||||||| |||| ||||| |
|
|
| T |
41337709 |
ggatttgaactccg-cccttgaggttataaggtcaaactcttaccactgagctgaca |
41337654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University