View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4844-Insertion-10 (Length: 333)
Name: NF4844-Insertion-10
Description: NF4844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4844-Insertion-10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 184 - 332
Target Start/End: Complemental strand, 39276383 - 39276229
Alignment:
| Q |
184 |
aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggtgga------aagtaacaactaaca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39276383 |
aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggaaaatactagtagtaacaactaaca |
39276284 |
T |
 |
| Q |
278 |
acctactattgaatacacttttggatctaactagtataactaacatttatgtcta |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276283 |
acctactattgaatacacttttggatctaactagtataactaacatttatgtcta |
39276229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 39276517 - 39276437
Alignment:
| Q |
8 |
tgacacatcataataacgaatgagatgcgtttctgtcctaattacacaaattagtttagtttagttggttccttcacacaagccat |
93 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39276517 |
tgacacatcataataacgaatcagatgcgtttctgtcctaattacacaaattagttt-----agttggttccttcacacaagccat |
39276437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University