View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4845-Insertion-10 (Length: 216)
Name: NF4845-Insertion-10
Description: NF4845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4845-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 8 - 151
Target Start/End: Complemental strand, 42158602 - 42158450
Alignment:
| Q |
8 |
ctgtaatgatgaaatcatgcgtaaatggccgagaaagagtaaagggactgggttga---------tgcaatcctttaggaaattggtcaaatatcatctt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158602 |
ctgtaatgatgaaatcatgcgtaaatggccgagaaagagtaaagggactgggttgactgggttgatgcaatcctttaggaaattggtcaaatatcatctt |
42158503 |
T |
|
| Q |
99 |
aagtatgttacggaagataggaaagctgtttccgatgccagaaagtctttgaa |
151 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158502 |
aaggttgttaccgaagataggaaagctgtttccgatgccagaaagtctttgaa |
42158450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University