View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4845-Insertion-9 (Length: 330)
Name: NF4845-Insertion-9
Description: NF4845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4845-Insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 7 - 187
Target Start/End: Original strand, 40782186 - 40782364
Alignment:
| Q |
7 |
atatagagaaatcatattcaatattcatatcatcacattattttatcatatatagtacattgagttactactannnnnnncatnnnnnnnnnncaagggt |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
40782186 |
atatagagaaatcgtattcaatattcatattatcacattattttatcatatatagtacattgagttactactatttttttcataaaaaaaa--caagggt |
40782283 |
T |
|
| Q |
107 |
agccatggcaagctccaagttcataggggctgttttcattgttttgttcattgtagacctagcatgtgcagctaggttact |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782284 |
agccatggcaagctccaagttcataggggccgttttcattgttttgttcattgtagacctagcatgtgcagctaggttact |
40782364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University