View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4845_high_4 (Length: 258)
Name: NF4845_high_4
Description: NF4845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4845_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 41580437 - 41580200
Alignment:
| Q |
1 |
acattgttcatttaggttaatccaatatataagttttc--aaaccatgctttcgcaaacgtttttaatcgaaaaactattattccccc-tctagtttttt |
97 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41580437 |
acattgtacatttagcataatccaatatataagttttttaaaaccatgctttcgcaaacgtttttaatcgaaaaactattattcccccctctagtttttt |
41580338 |
T |
 |
| Q |
98 |
cttgttattgtcatatcggccaacggtaactagcttgaccaattacttgcagggaacactataagctatgagtggtatgtgccacttatggtatacacat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41580337 |
cttgttattgtcatatcggccaacggtaactagcttgaccaattacttacagggaacactataagctatgagtggtatgtgccacttatggtatacacat |
41580238 |
T |
 |
| Q |
198 |
gatatctctagttaagggtgtgaattgtctcacttgag |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41580237 |
gatatctctagttaagggtgtgaattgtctcacttgag |
41580200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University