View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4846-Insertion-10 (Length: 186)

Name: NF4846-Insertion-10
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4846-Insertion-10
NF4846-Insertion-10
[»] chr3 (1 HSPs)
chr3 (8-186)||(51705195-51705373)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 4e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 4e-92
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 51705373 - 51705195
Alignment:
8 tttgttagtacgatagttcataaagacacatctaaccgcacaagaatctacgttgatttggtgttacttgtgaatacccaaaaaatcaacacgccaaaat 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
51705373 tttgttagtacgatagttcataaagacacatctaaccgcacaagaatctacgttgatttggtgttacttgtgaataccgaaaaaatcaacatgccaaaat 51705274  T
108 attcatgattcaaaactatgcatgacaattacaaaaggaaaaaatgagatcctaaactgaacaagaccaatggtactta 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51705273 attcatgattcaaaactatgcatgacaattacaaaaggaaaaaatgagatcctaaactgaacaagaccaatggtactta 51705195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University