View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846-Insertion-19 (Length: 213)
Name: NF4846-Insertion-19
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846-Insertion-19 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 471621 - 471826
Alignment:
| Q |
8 |
tttatgatgcacttacaacatcaaataatttccattttattcctctctttcttttgaatttgctaaaaataattaaaagtttaattcttccatcttcatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471621 |
tttatgatgcacttacaacatcaaataatttccattttattcctctctttcttttgaatttgctaaaaataattaaaagtttaattcttccatcttcatc |
471720 |
T |
 |
| Q |
108 |
tcccaactttataccgaggtnnnnnnnnnttcaacaacagaaaacccattattgttgagatctttgaatttattttcttcatccaactagactatggtga |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471721 |
tcccaactttataccgaggtaaaaacaagttcaacaacagaaaacccattattgttgagatctttgaatttattttcttcatccaactagactatggtga |
471820 |
T |
 |
| Q |
208 |
ccttcc |
213 |
Q |
| |
|
|||||| |
|
|
| T |
471821 |
ccttcc |
471826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University