View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_high_12 (Length: 237)
Name: NF4846_high_12
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 41931680 - 41931476
Alignment:
| Q |
19 |
gaaaatatattcgtgggatgaatttttagaagtggtgggttattattactatttttcctcctatctgttgcaaatttgtcatgaaaaagctccttctaga |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
41931680 |
gaaaatatattcatgggatgaatttttagaagtggtgggttattattactatttttcctcctatctgttgcaaatttgtcatgaaaaagctc----tgga |
41931585 |
T |
|
| Q |
119 |
tacacttcttgcattgcaagttttgtttctaacactcagtccagaaatgacaagaggaggttatgttttacgattgttttatcgatattttgtggatgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41931584 |
tacacttcttgcattgcaagttttgtttctaacactcagtccagaaatgacaagaggaagttatgttttacgattgtcttatcgatattttgtggttgga |
41931485 |
T |
|
| Q |
219 |
ttgctcatt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
41931484 |
ttgctcatt |
41931476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University