View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_high_15 (Length: 214)
Name: NF4846_high_15
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 50473851 - 50473646
Alignment:
| Q |
9 |
gcagaacctgtggctgcggcagtacaatcaccagcattatcaccatctcctgacaaccggttggatgcttttgcactattacgttcctcgagagccttct |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50473851 |
gcagaacctgtagctgcggcagtacaatcaccagcattatcaccatctcctgacaaccggttggatgctattgcactattacgttcctcgagagccttct |
50473752 |
T |
 |
| Q |
109 |
gcctcgaccttgacctttgcaactttgctagtgacactgctgggtcattgaaactctcggagactcttggttctatctgattctgaggtgaaatagcacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50473751 |
gcctcgaccttgacctttgcaactttgctagtgacactgctgggtcatggaaactctcggagactcttggttctatctgattctgaggtgaaatagcacc |
50473652 |
T |
 |
| Q |
209 |
tgaatc |
214 |
Q |
| |
|
|||||| |
|
|
| T |
50473651 |
tgaatc |
50473646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University