View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_12 (Length: 265)
Name: NF4846_low_12
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 255
Target Start/End: Original strand, 39381395 - 39381643
Alignment:
| Q |
7 |
acatgggccgctatattaacgcaactgcgattgatgctgtatcagcgtgattctatgcaatatcaataattgcaatcgagaccattacttccattgcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39381395 |
acatgggccgctatattaacgcaactgcgattgaggctgtatcagcatgattctatgcaatatcaataattgtaatcgagaccattacttccattgcaat |
39381494 |
T |
 |
| Q |
107 |
ttaaaaatttgataatagtgtaaaccggtttcacacttacatgacgataagcgtaaatcagctttacacatttataatgggagtcaactattttgtcacg |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39381495 |
ttaaaaatttgatattagtgtaaaccggtttcacacttacatgatgataagtgtaaatcagctttacgcatttataatgggagtcaactattttgtcacg |
39381594 |
T |
 |
| Q |
207 |
cgagtccacctttgtaactacatcttgaatttaacgatattatgatgat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39381595 |
tgagtccacctttgtaactacatcttgaatttaacgatattatgatgat |
39381643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University