View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_17 (Length: 223)
Name: NF4846_low_17
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_17 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 10705520 - 10705739
Alignment:
| Q |
4 |
gggtagattattcttatctgctaaaatagccgaatgcaaagcagttccaactgaagattttgggttgattcggaatgccatacggaaatgatgttcagag |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10705520 |
gggtagatttttcttatctgctaaaatagccgaatgcaaagcagttccaactgaagattttgggttgattcggaatgccatacggaaatgatgttcagag |
10705619 |
T |
 |
| Q |
104 |
aactcaaatttctcttggtgccttgatatctagcagtgaatgtggcggtaatggttattattactcacttctgggatgtggcaccgcgtaggtaagtggt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10705620 |
aactcaaatttctcttggtgccttgatatctagcagtgaatgtggcggtaatggttattattactcacttctgggatgtggcaccgcgtaggtaagtggt |
10705719 |
T |
 |
| Q |
204 |
gcaacactcgggcgctattt |
223 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
10705720 |
gcaacactcaggcgctattt |
10705739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 56 - 123
Target Start/End: Complemental strand, 6391565 - 6391498
Alignment:
| Q |
56 |
gaagattttgggttgattcggaatgccatacggaaatgatgttcagagaactcaaatttctcttggtg |
123 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6391565 |
gaagattttgggttgattcggaaagccatacggaaatgatgttcagagaactcaaatttctcttggtg |
6391498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University