View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_5 (Length: 368)
Name: NF4846_low_5
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 289 - 340
Target Start/End: Complemental strand, 30770009 - 30769958
Alignment:
| Q |
289 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaactcca |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770009 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagcggaaactcca |
30769958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 30772667 - 30772611
Alignment:
| Q |
25 |
actcatcttttccattgaaaatttccaccggtcattatccatacactctcctctcta |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30772667 |
actcatcttttccattgaaaatttccacctgtcatattccatacactctcctctcta |
30772611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 289 - 340
Target Start/End: Complemental strand, 30758259 - 30758208
Alignment:
| Q |
289 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaactcca |
340 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30758259 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagtggaaactcca |
30758208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 289 - 337
Target Start/End: Complemental strand, 30769813 - 30769765
Alignment:
| Q |
289 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaact |
337 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30769813 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagtggaaact |
30769765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 30770855 - 30770815
Alignment:
| Q |
249 |
gattagtgttgttatctatacctggcgctgattgtgcttgt |
289 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30770855 |
gattagtgttgttatctatacctggtgctgattgtgcttgt |
30770815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University