View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_6 (Length: 347)
Name: NF4846_low_6
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 109 - 331
Target Start/End: Complemental strand, 3105157 - 3104928
Alignment:
| Q |
109 |
gaattaatataacattgatcgttgaatccagaaatacaattatccacttgaacaatttttcagaaaagtaaatacacaattgatttggtcactttagatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3105157 |
gaattaatataacattgatcgttgaatccagaaatacaattatccacttgaacagtttttcagaaaactaaatacacaattgatttggtcactttagatg |
3105058 |
T |
 |
| Q |
209 |
gaat-------tccatattcaacatgcatcaagttcttcttctgatcattcttcaattgatttgattccacactgcaaataaaagtcacaaaatatatta |
301 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3105057 |
gaatactcctttccatattcaacatgcatcaagttcttcttctgatcattcttcaattgatttgattccacactgcagataaaagtcacaaaatatatta |
3104958 |
T |
 |
| Q |
302 |
aacatatatatcagagaacaaatatagtag |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3104957 |
aacatatatatcagagaacaaatatagtag |
3104928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University