View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_8 (Length: 309)
Name: NF4846_low_8
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 22 - 301
Target Start/End: Complemental strand, 10706036 - 10705757
Alignment:
| Q |
22 |
gtgctaaggcctttgatatctgttgatatagtttggtgatcgatgccagatagaattatgattctacggccaagtgccaacctaatatgtcgaactctga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10706036 |
gtgctaaggcctttgatatctgttgatatagtttggtgatcgatgccagatagaattatgattctacggccaagtgccaacctaatatgtcgaactctgg |
10705937 |
T |
 |
| Q |
122 |
cttaagatgtcatgttctcatatttgttcggctcacctagaaagtaacgaatgtatgaatggcgtgcttatgtaagaggcattcccctcatcctctttta |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10705936 |
cttaagatgtaatgttctcatatttgttcggctcacctagaaagtaacgaatgtatgaatggcgtgcttatgtaagaggcattcccctcatcctctttta |
10705837 |
T |
 |
| Q |
222 |
gcttgcaaaattgaggaagctgtatttaatagttatgcacttctgcccttcgcatcgactaaatattatccccttggtct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10705836 |
gcttgcaaaattgaggaagctgtatttaatagttatgcacttctgcccttcgcatcgactaaatattatccccttggtct |
10705757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 67 - 117
Target Start/End: Original strand, 6388751 - 6388801
Alignment:
| Q |
67 |
ccagatagaattatgattctacggccaagtgccaacctaatatgtcgaact |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6388751 |
ccagatagaattttgattctacggccaagtgccaacctaatatgttgaact |
6388801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University