View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4846_low_9 (Length: 307)
Name: NF4846_low_9
Description: NF4846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4846_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 7e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 193 - 296
Target Start/End: Complemental strand, 27896839 - 27896736
Alignment:
| Q |
193 |
atgagttatagttgcacgataactttcaattcaatcttttgttcaggtaatcaatttaacgcgtatatttttgttgaaccattgttgtttacattatgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27896839 |
atgagttatagttgcacgataactttcaattcaatcttttgttcaggtaatcaatttaacgcgtatatttttgttgaaccattgttgtttacattatgat |
27896740 |
T |
|
| Q |
293 |
gatg |
296 |
Q |
| |
|
|||| |
|
|
| T |
27896739 |
gatg |
27896736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 60 - 115
Target Start/End: Complemental strand, 27897502 - 27897447
Alignment:
| Q |
60 |
atagtgaatcaaaaattgattaaaacatataaaaacaatattcacatgtaatgtcc |
115 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
27897502 |
atagtgaatcaaaaattgattcagacatataaaaacaatattcacatgtaatgtcc |
27897447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 27897776 - 27897729
Alignment:
| Q |
17 |
agtataagctaggcttgagtccaacataatggtctaaaattacatagt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897776 |
agtataagctaggcttgagtccaacataatggtctaaaattacatagt |
27897729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University