View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4847_high_6 (Length: 269)
Name: NF4847_high_6
Description: NF4847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4847_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 45 - 259
Target Start/End: Complemental strand, 34075206 - 34074992
Alignment:
| Q |
45 |
gaaaagtataataggttaattagttgttcccctgatccgtaagtgcaactcaaatggtagctcctacgatatttgatatgttggggcgtgggttcgcacc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34075206 |
gaaaagtataataggttaattagttgttcccctgatccgtaagtgcaactcaaatggtagctcctacgatatttgatatgttggggcgtgggttcgcacc |
34075107 |
T |
 |
| Q |
145 |
ttcaattctccacttctccacgtttcaacacttggtgagcgagtttcgccgctagactgttttgaaccagaaaaatcaaataattagctcttccccatcc |
244 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34075106 |
ttcaattctccacttctccacttttcaacacttggtgcgcgagtttcgccgctagactgttttgaaccagaaaaatcaaataattagctcttccccatcc |
34075007 |
T |
 |
| Q |
245 |
ctcgtgaaccctatg |
259 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34075006 |
ctcgtgaaccctatg |
34074992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University