View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4847_high_8 (Length: 264)
Name: NF4847_high_8
Description: NF4847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4847_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 52 - 209
Target Start/End: Original strand, 34074799 - 34074956
Alignment:
| Q |
52 |
taactaggttttatgccaggaccataaaagcaatatacttgctacgagaactcatggagaggtattagaggaatgaaaaagaaattacatggttgatatt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34074799 |
taactaggttttatgccaggaccataaaagcaatatacttgctacgagaactcatggagaggtattagaggaatgaaaaagaaattacatggttgatatt |
34074898 |
T |
 |
| Q |
152 |
aattaagaggttttagagaagcaatgtatttagattgcttatgtttgattaataaaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34074899 |
aattaagaggttttagagaagcaatgtatttagattgcttatgtttgattaataaaag |
34074956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 228 - 264
Target Start/End: Original strand, 34074967 - 34075003
Alignment:
| Q |
228 |
taagggatcacggctactgtgcgaacatagggttcac |
264 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34074967 |
taagggatcacggctattgtgcgaacatagggttcac |
34075003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University