View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4848-Insertion-5 (Length: 307)
Name: NF4848-Insertion-5
Description: NF4848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4848-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 24270083 - 24270294
Alignment:
| Q |
8 |
aatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattatcgatagcccatttgagagcgatcttgcttcctttggagaaatctaaagc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24270083 |
aatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattgtcgatagcccatttgagagcgatcttgcttcctttggagaaatctaaagc |
24270182 |
T |
|
| Q |
108 |
tacaccaatttgcctaccactcgccatgtttttctttttggtgaacagcacaagttctgaactgaactatgataagatattcacaattcacctatgacta |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24270183 |
tacaccaatttgccttccactcgccatgtttttctttttggtgaacagcacaagtt-----ctgaactatgataagatattcacaagtcacctatgacta |
24270277 |
T |
|
| Q |
208 |
tgagctttcaactttgt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24270278 |
tgagctttcaactttgt |
24270294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University