View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4848_low_11 (Length: 237)
Name: NF4848_low_11
Description: NF4848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4848_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 112 - 221
Target Start/End: Original strand, 40269351 - 40269460
Alignment:
| Q |
112 |
ctaggtgttgaagaaaccaaagcaattcaagtggactatatagcatgagcaagttttcgaagaactaaagaaatttttgtcatcagctccagtgtcaatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||| |
|
|
| T |
40269351 |
ctaggtgttgaagaaaccaaagcaattcaagtggactatttagcatgagcaagttttcgaagaactaaagaaatttttgtcgtcaactccagtgtcgatc |
40269450 |
T |
|
| Q |
212 |
gagaaaaggg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
40269451 |
gagaaaaggg |
40269460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University