View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4848_low_12 (Length: 234)
Name: NF4848_low_12
Description: NF4848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4848_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 48915696 - 48915485
Alignment:
| Q |
18 |
tttcatacaataagcatgtgtttgagcaaatcttgagtggacacaagaatttgaattcaagtatactccatttagttgatttacggtattggatgcatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48915696 |
tttcatacaataagcatgtgtttgagcaaatcttgagtggacacaagaatttgagttcaggtatactccatttagttgatttacgatattggatgcatga |
48915597 |
T |
 |
| Q |
118 |
tatatgacaaaataacacccaatggtcaagatttaaaattaaaatcacagccatgccctcttccaatttacacccctcttcctttcatgcgagattcacg |
217 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48915596 |
tatatggcaaaataacatccaatggtcaagatttaaaattaaaatcagagtcatgccctcttccaatttacacccctcttcctttcatccgagattcacg |
48915497 |
T |
 |
| Q |
218 |
tttctctcctct |
229 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
48915496 |
tttctcccctct |
48915485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 96 - 219
Target Start/End: Original strand, 30552161 - 30552284
Alignment:
| Q |
96 |
atttacggtattggatgcatgatatatgacaaaataacacccaatggtcaagatttaaaattaaaatcacag-ccatgccctcttccaatttacacccct |
194 |
Q |
| |
|
||||| ||| || ||||||||| || || |||||||||| ||| |||||| || ||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
30552161 |
atttagggtcttagatgcatgacatgtggcaaaataacattcaagggtcaaaatctaaaattaaaatcacagaccatgccctcttccaatttacacccgt |
30552260 |
T |
 |
| Q |
195 |
cttcctttcatgcgagattcacgtt |
219 |
Q |
| |
|
||||||||||| | ||||||||||| |
|
|
| T |
30552261 |
cttcctttcat-ccagattcacgtt |
30552284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 48923088 - 48923042
Alignment:
| Q |
156 |
ttaaaatcacagccatgccctcttccaatttacacccctcttccttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48923088 |
ttaaaatcacagccatgccctcttccaatttacacccctcttccttt |
48923042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University