View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4848_low_13 (Length: 228)

Name: NF4848_low_13
Description: NF4848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4848_low_13
NF4848_low_13
[»] chr7 (1 HSPs)
chr7 (1-209)||(5232092-5232295)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 5232295 - 5232092
Alignment:
1 gcctttcaagctgctcaagatccttagaacttagtggacccaaatcttcacctaaaagatttctgaaatattggagacacatacatacacacacaattaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||    
5232295 gcctttcaagctgctcaagatccttagaacttagtggacccaaatcttcacctaaaagatttctgaaatattggagacaca----tacacacacaattaa 5232200  T
101 tagtgtcgatatattggcaaatatttcactatagaaaatatgaaaatttaatgtaaaattctttacctctgtgctctttgaagattttcaaatctttgtt 200  Q
    ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5232199 tagtgtcgatatattggcaaatatttcactataaaaaatatgaaaa-ttaatgtaaaaatctttacctctgtgctctttgaagattttcaaatctttgtt 5232101  T
201 tcagcttca 209  Q
    |||||||||    
5232100 tcagcttca 5232092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University