View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4849_high_5 (Length: 201)
Name: NF4849_high_5
Description: NF4849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4849_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 38710863 - 38711047
Alignment:
| Q |
1 |
tggagaatgtgtaggggcagtccatccggtagcacttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggta |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38710863 |
tggagaatgtgtaggggcagtccaaccggtagcacttggtgtcggagcattccaacccgatgattttgttggagaatgtgcaggagcagtccaaccggta |
38710962 |
T |
|
| Q |
101 |
gcacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgccggagtagtccaaccggtggcacttggtgaagaag |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38710963 |
gcacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgtcggagtagtccaaccggtagcacttggtgaagaag |
38711047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 38710932 - 38711113
Alignment:
| Q |
1 |
tggagaatgtgtaggggcagtccatccggtagcacttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggta |
100 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||||| ||||||| |||||||| ||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
38710932 |
tggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgtcggagtagtccaaccggta |
38711031 |
T |
|
| Q |
101 |
gcacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgccggagtagtccaaccggtggcacttggtgaag |
182 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||| |||||||| |||| |||||| ||||| ||||||||||||| |
|
|
| T |
38711032 |
gcacttggtgaagaagcactccaagtcggtgattgtgttggggagtgtgcgggagcagtccagccggtagcacttggtgaag |
38711113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 34 - 182
Target Start/End: Original strand, 38710827 - 38710975
Alignment:
| Q |
34 |
acttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggagcatgccaagccggtgat |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||||||||||||| ||||||| |||| ||| |||| |
|
|
| T |
38710827 |
acttggtgtcggagcattccaagctgatgattgtgctggagaatgtgtaggggcagtccaaccggtagcacttggtgtcggagcattccaacccgatgat |
38710926 |
T |
|
| Q |
134 |
tgtgttggagagtgtgccggagtagtccaaccggtggcacttggtgaag |
182 |
Q |
| |
|
| ||||||||| ||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
38710927 |
tttgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaag |
38710975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 38711001 - 38711143
Alignment:
| Q |
1 |
tggagaatgtgtaggggcagtccatccggtagcacttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggta |
100 |
Q |
| |
|
|||||| ||||| || | |||||| |||||||||||||||| | |||| |||||| || |||||||||||| || ||||| ||||||||||| |||||| |
|
|
| T |
38711001 |
tggagagtgtgtcggagtagtccaaccggtagcacttggtgaagaagcactccaagtcggtgattgtgttggggagtgtgcgggagcagtccagccggta |
38711100 |
T |
|
| Q |
101 |
gcacttggtgaaggagcatgccaagccggtgattgtgttggag |
143 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
38711101 |
gcacttggtgaaggagcattccaaaccggtgattgtgttggag |
38711143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 38711086 - 38711239
Alignment:
| Q |
17 |
gcagtccatccggtagcacttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggag |
116 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||| |||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
38711086 |
gcagtccagccggtagcacttggtgaaggagcattccaaaccggtgattgtgttggag------------cagtcttgctggtagcacttggtgaaggag |
38711173 |
T |
|
| Q |
117 |
catgccaagccggtgattgtgttggagagtgtgccggagtagtccaaccggtggcacttggtgaag |
182 |
Q |
| |
|
| | |||||| |||||||||| ||| ||||||| |||| | |||||||| | ||||||||||||| |
|
|
| T |
38711174 |
ccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaag |
38711239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 38711154 - 38711245
Alignment:
| Q |
28 |
ggtagcacttggtgtcggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggagcat |
119 |
Q |
| |
|
|||||||||||||| ||||| |||||||| | |||||||| ||| || |||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38711154 |
ggtagcacttggtgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcat |
38711245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 141
Target Start/End: Complemental strand, 39705050 - 39704953
Alignment:
| Q |
44 |
ggagcattccaagccgatgattgtgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggagcatgccaagccggtgattgtgttgg |
141 |
Q |
| |
|
|||||||||||||| | |||||| ||| || ||||| ||||||||||| | ||||||||||||| ||||||| |||||| |||| ||||||||| |
|
|
| T |
39705050 |
ggagcattccaagctggcgattgtactggggagtgtgccggagcagtccagacaatagcacttggtgagggagcattccaagctggtggttgtgttgg |
39704953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 39704878 - 39704825
Alignment:
| Q |
102 |
cacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgccggag |
155 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
39704878 |
cacttgatgagggagcattccaagccggtggttgtgttggggagcgtgccggag |
39704825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University