View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850-Insertion-6 (Length: 120)
Name: NF4850-Insertion-6
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 15 - 120
Target Start/End: Complemental strand, 55133521 - 55133416
Alignment:
| Q |
15 |
catgcatggaatcacacgcgattcacattattcacgtaaatctatacgatatgttaagatcgttaattatttagtaattttatagattgctaaagatctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55133521 |
catgcatggaatcacacgcgattcacattattcacgtaaatctatacgatatgttaagatcgttaattatttagtaattttatagattgctaaagatctc |
55133422 |
T |
 |
| Q |
115 |
atggta |
120 |
Q |
| |
|
|||||| |
|
|
| T |
55133421 |
atggta |
55133416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University